We narrowed to 14,247 results for: RON
-
Plasmid#48633PurposeBacterial expression vector encoding for the 6XHis tagged redox probe roGFPiL (roGFP C147, L147b, C204)DepositorInsertroGFP1
TagsHisTagMutationinsertion L147BAvailable SinceOct. 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSEM396 - mosTI unc-119 - NNN - operon - gfp - tbb-2
Plasmid#182353PurposeGFP co-expression cloning vector for mosTI(unc-119). Transgene inserted upstream of gpd-2 operon::gfp::tbb-2 3'UTR. MCS or Golden Gate (BsaI: tgcc - MCS - tgag)DepositorTypeEmpty backboneExpressionWormAvailable SinceMay 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2211 - [1-2] ENTR - Fluor - mMaple3(intron, PATC, no_atg, no_stop)
Plasmid#159866PurposeThree-fragment Gateway compatible flourophore for expression in C. elegansDepositorInsert[1-2] ENTR - Fluor - mMaple3(intron, PATC, no_atg, no_stop)
ExpressionWormMutationNot applicableAvailable SinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET His6 Sumo TEV cloning vector with BioBrick polycistronic restriction sites (9S)
Plasmid#48291DepositorTypeEmpty backboneTagsHis6 and SumoExpressionBacterialAvailable SinceSept. 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSF4 TetCMV 5'TOP intron 20xGCN4 Renilla FKBP Stop 24xMS2v5 SV40 CTE polyA
Plasmid#119946PurposeExpresses 5'TOP-SunTag-Renilla mRNA reporter in mammalian cells; note plasmid contains 24xGCN4 repeatsDepositorInsertRenilla luciferase
Tags24xGCN4 repeats (SunTag), 24xMS2v5 stem loops in …ExpressionBacterial and MammalianPromoterTetCMVAvailable SinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTBL1269 pLenti-CHYRON17-pEF1a(short)-Luc2-P2A-tdTomato-T2A-TdT
Plasmid#163643PurposeMakes a lentivirus that expresses hgRNA with 17nt spacer and Luc2, tdTomato, and human TdT.DepositorInsertsUseLentiviralTagsLuc2-P2A-tdTomato-T2AMutationThe SpCas9 sgRNA constant region is mutated to ma…PromoterEFS and pU6Available SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMVenh synapsin-intron-aSYNUCLEIN WT
Plasmid#247940PurposeAAV transfer plasmid encoding the human α-SYN under the control of the CMVie enhanced synapsin1 promoterDepositorAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pdDronpa1.2-Talin1(1974–2541)-mIFP
Plasmid#249168PurposeMammalian expression vector of talin1 C-terminal fragment fused with pdDronpa1.2DepositorInsertTalin1 (TLN1 Human)
TagsmIFP and pdDronpa1.2ExpressionMammalianMutationDeleted amino acids 1–1973PromoterCMVAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DIO-DjCas13d-pA
Plasmid#192498PurposeTo express DjCas13d in a Cre dependent mannerDepositorInsertDjCas13d
UseAAVMutationNoPromoterCMVAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSA358_pAAV-SCP1-Intron-eGFP-CS1
Plasmid#215513PurposeSingle stranded AAV eGFP reporter vector with SCP1 promoter.DepositorInserteGFP
UseAAVExpressionMammalianPromoterSCP1Available SinceAug. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKG3831_pGEEC579_pShip-UbC(no_intron)-mRuby2-bGH
Plasmid#239742PurposePlasmid expressing mRuby from a UbC promoter lacking an intron, used for modRNA productionDepositorInsertmRuby2
UseSynthetic BiologyAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKG3774_pGEEC580_pShip-EF1a(no_intron)-mRuby2-bGH
Plasmid#239743PurposePlasmid expressing mRuby from an EF1a promoter lacking an intron, used for modRNA productionDepositorInsertmRuby2
UseSynthetic BiologyAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
SpyTag-RBD Omicron XBB.1.5
Plasmid#214724PurposeExpresses SARS-CoV-2 Omicron XBB.1.5 RBD (receptor-binding domain from Spike) with N-terminal SpyTag fusion in mammalian cellsDepositorAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-tubgenomic-PTC62-deltaIntron3_D
Plasmid#146146PurposeMammalian Expression of tubgenomic-PTC62-delIntron3DepositorInserttubgenomic-PTC62-delIntron3
ExpressionMammalianAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DIO-hfCas13d-pA
Plasmid#195866PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2365 - Intron GG1 - 250bp no PATC
Plasmid#159883PurposeGolden Gate compatible intron with no PATCs for negative controlsDepositorInsertIntron GG1 - 250bp no PATC
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2345 - Intron GG2 - 250bp no PATC
Plasmid#159884PurposeGolden Gate compatible intron with no PATCs for negative controlsDepositorInsertIntron GG2 - 250bp no PATC
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2366 - intron GG3 - 250bp no PATC
Plasmid#159885PurposeGolden Gate compatible intron with no PATCs for negative controlsDepositorInsertintron GG3 - 250bp no PATC
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
Dox human Citron shRNA 1 GFP
Plasmid#155291PurposeLentivirus for doxycycline inducible expression of human Citron shRNA, GFP marker, based on Addgene 11652DepositorInsertCitron (CIT Human)
ExpressionMammalianAvailable SinceAug. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
Drosophila Nedd2-like caspase (DRONC)
Plasmid#157778PurposeE. coli expression vector pET23 with C-term 6xHis tagDepositorInsertDrosophila Nedd2-like caspase (DRONC) (Dronc Fly)
Tags6x HISExpressionBacterialPromoterT7Available SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only