We narrowed to 83,057 results for: Mycs
-
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-TetOn-3XFLAG-firefly-beta-globin-control-AAVS1
Plasmid#184395PurposeDonor plasmid for stable integration of firefly luciferase control reporter at AAVS1DepositorInsertFirefly luciferase beta-globin
UseCRISPR; Donor plasmid for hdrTags3X FLAGExpressionMammalianPromoterTet-On 3GAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh.TP-CNOT8-V5H6.MCh.Puro
Plasmid#209947PurposeIn mammalian cells expresses TP fused to a CNOT8 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 8 (CNOT8 Human)
mCherry fluorescent protein fused to puromycin resistance marker
TagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianPromoterCBh and CMVAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
p28-2iDP-puro
Plasmid#88893PurposeDual-intron DMD platform plasmid. Co-expresses DMD platform segment, firefly luciferase, puroR and mCherry. Plasmid carries phiC31 and Bxb1 attB sites.DepositorInsertsDual-intron DMD platform
luciferase
puromycin resistance enzyme
mCherry
ExpressionMammalianMutationTruncated version of the dystrophin protein (tran…Available SinceJan. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-TetOn-3XFLAG-renilla-beta-globin-control-AAVS1
Plasmid#184396PurposeDonor plasmid for stable integration of Renilla luciferase control reporter at AAVS1DepositorInsertRenilla luciferase beta-globin
UseCRISPR; Donor plasmid for hdrTags3X FLAGExpressionMammalianPromoterTet-On 3GAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-mCherry-mCherry-FLARE-AKAR
Plasmid#123333PurposeRed-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase A activity.DepositorInsertmCherry-mCherry-FLARE-AKAR
Tags6xHIS, T7 tag (gene 10 leader), Xpress (TM) tag, …ExpressionMammalianPromoterCMVAvailable SinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJW1821
Plasmid#163092PurposeCRISPR repair template: add insertion site specific homology arms by PCR before insertionDepositorInsertmScarlet^SEC (Lox511I)^::3xMyc
UseCRISPR and Cre/LoxExpressionWormAvailable SinceJan. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-VSVg-StrepTagII-HA
Plasmid#162100PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to VSVg-StrepTagII-HA
UseLentiviralTagsVSVg-StrepTagII-HAMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only