173,384 results
-
Plasmid#140019PurposePlasmid with 4xEcoLeuT(CUA) cassette and E. coli AnapRS for amber suppression and incorporation of the fluorescent ncAA Anap; for transient or stable piggyBac-mediated integrationDepositorInsertEcoLeuRS (AnapRS)
ExpressionMammalianMutationL38F, M40G, L41P, Y499V, Y500L, Y527A, H537E, L53…PromoterEF1Available SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
LEGO-AP1x6-GM55
Plasmid#217415PurposeLuciferase expression vector with 6 AP-1 sites and the minimal GM-CSF promoter. Alias: LEGO-GM55-AP-1x6DepositorInsertLuciferase, GFP
UseLentiviral and LuciferaseExpressionMammalianPromoter6 AP-1 sites, Human -55 to +28 minimal CSF2 promo…Available SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
lenti F9-TetR-EGFP-IRES-PuroR
Plasmid#117049Purposelentiviral vector for expression of TetR-EGFP, for visualization of TetO repeatsDepositorInsertF9-TetR-EGFP
UseLentiviralTagsEGFPExpressionMammalianPromoterF9 promoterAvailable SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-CamKIIa-jGCaMP8s-WPRE
Plasmid#176752PurposeAAV-mediated expression of GCaMP8s under the CamKIIa promoterDepositorHas ServiceAAV Retrograde, AAV1, AAV5, and AAV9InsertjGCaMP8s
UseAAVTags6xHisExpressionMammalianPromoterCamKIIalphaAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
Nrp2.1-Fc-His
Plasmid#72098PurposeExpresses the extracellular region of the Neuropilin 2, isoform 1 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
Flag-V0A
Plasmid#210347PurposeExpresses ATP6V0A in mammalian cellsDepositorAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEDA5_GFPmut3_Y66H
Plasmid#80085PurposePositive control plasmid for Nicking Mutagenesis. Constitutively expresses a non-fluorescent variant of GFPmut3 (Y66H) that is mutated to fluorescent (H66Y) in the protocol.DepositorInsertGFPmut3_Y66H
Tags6x-His tagExpressionBacterialMutationchanged Tyrosine 66 to HistidinePromoterproBAvailable SinceJuly 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMRE-Tn7-141
Plasmid#118557PurposeminiTn7 plasmid to deliver constitutively expressed fluorescent protein genes in bacteriaDepositorInsertmTurquoise2
UseMinitn7 delivery vectorExpressionBacterialAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAC-BETA
Plasmid#53272PurposeContains crtE, crtB, crtI, and crtY carotenoid pathway genes of Erwinia herbicola (Pantoea agglomerans) Eho10 and thereby produces beta-carotene in Escherichia coliDepositorInsertcrtE, crtY, crtI, crtB
UseLow copy number bacterial cloning vectorPromoterendogenous promotersAvailable SinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
anti-FLAG M2 heavy chain
Plasmid#175359PurposeMammalian expression vector for over-expression of anti-FLAG M2 heavy chain (C-terminal His8)DepositorInsertanti-FLAG M2 heavy chain
TagsHis8 tag and N-terminal secretion signal peptide …ExpressionMammalianMutationL51I (see paper)PromoterCMVAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pQE-WT-RGVG-M6
Plasmid#70172PurposeExpresses RGVG-M6 T7 RNA polymerase variant with enhanced transcription of 2' modified RNADepositorInsertRGVG-M6 T7 RNA polymerase
TagsHisExpressionBacterialPromoterT5/LacAvailable SinceDec. 16, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV_OHu19986C_myc tag
Plasmid#183174Purposeused to make AAV vectors for hsTRPA1 tagged with mycDepositorAvailable SinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCD5-H1MI15-CO-GCN4-TEV-sfGFP-TS
Plasmid#158741PurposeExpresses influenza A virus trimeric hemagglutinin A/H1/MI/15 fused to a sfGFPDepositorInsertHemagglutinin A/MI/45/15 H1N1
TagsGCN4-TEV-sfGFP-TwinStrepExpressionMammalianMutationAA61-469PromoterCMVAvailable SinceNov. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMS114
Plasmid#215677PurposeEmpty repair plasmid for ChrI split hygromycinR landing padDepositorInsert5'HA + MCS + loxN + rps-0p::5'ΔHygR
UseCRISPR and Cre/LoxExpressionWormMutation5' ∆HYGR encodes aa1-226Available SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-eNpHR 3.0-EYFP
Plasmid#26972PurposeAAV expression of eNpHR 3.0 fused to EYFP driven by humanized Synapsin promoter for optogenetic inhibitionDepositorHas ServiceAAV2 and AAV5InserteNpHR 3.0
UseAAVTagsEYFPExpressionMammalianMutationTrafficking Signal (TS) ER Export SignalPromoterhSynAvailable SinceFeb. 4, 2011AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Fon-Synaptophysin-10xMyc-WPRE
Plasmid#237446PurposeIntersectional expression of Myc-tagged synaptophysin in the presence of Cre and FlpDepositorInsertCon/Fon-Synaptophysin-10xMyc
UseAAVExpressionMammalianPromoterEF1aAvailable SinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
NanoBRET Assay Vector, MEK1-NanoLuc
Plasmid#238577PurposeExpress MEK1-NanoLuc Fusion Protein in Mammalian Cells under a CMV promoterDepositorHas ServiceDNAInsertMEK1 (MAP2K1 Human)
TagsNanoLuc (R)ExpressionMammalianMutationNonePromoterCMVAvailable SinceSept. 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
anti-FLAG M2 light chain
Plasmid#175358PurposeMammalian expression vector for over-expression of anti-FLAG M2 light chainDepositorInsertanti-FLAG M2 light chain
TagsN-terminal secretion signal peptide (MEAPAQLLFLLL…ExpressionMammalianPromoterCMVAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMS59
Plasmid#215680PurposeCas9 + guide plasmid targeting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
TRE-UBC-mCD55-T2A-GFP
Plasmid#205450Purposelentiviral plasmid for expression of mouse CD55DepositorAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only