We narrowed to 1,677 results for: tyr
-
Plasmid#126524Purposeexpresses TAL (Rhodobacter sphaeroides) and 4CL (Arabidopsis thaliana paralog 1) for PYP chromophore biosynthesisDepositorInsertsTagsHisExpressionBacterialPromoterT7Available SinceJune 25, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-DYRK1A-2A-mCherry
Plasmid#118272PurposeExpresses mouse DYRK1A tagged with 2A peptide at it's C-terminus and mCherry in mammalian cells.DepositorInsertdual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1a (Dyrk1a Mouse)
UseAAVTags2A peptide and mCherryExpressionMammalianPromoterCMV with beta global intronAvailable SinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-EphB3-Fc
Plasmid#200985PurposeMammalian expression plasmid for soluble EphB3 fused to IgG1 FcDepositorInsertEphB3 (EPHB3 Human)
TagsFc region of human IgG1ExpressionMammalianMutationSoluble ectodomain of EphB3PromoterCMVAvailable SinceOct. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-PM-RA-BlastR
Plasmid#211708PurposeLentiviral expression of a ddFP subunit (RA) fused with the lipid modification motif of lymphocyte-specific protein tyrosine kinase (Lck) for plasma membrane (PM) targetting (PM-RA)DepositorAvailable SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET23a-H6-TEV-cSrc
Plasmid#214233PurposeBacterial expression of the kinase domain of cSrc with a TEV-cleavable N-terminal 6xHis affinity tag; For in vitro tyrosine phosphorylation in peptides/proteins and for kinase specificity screeningsDepositorAvailable SinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-EphB2
Plasmid#200982PurposeMammalian expression plasmid for myc-tagged EphB2DepositorInsertEphB2 (EPHB2 Human)
TagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianPromoterCMVAvailable SinceOct. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCI-Myc3-HPS4
Plasmid#133931PurposeExpresses 3xMyc-HPS4 construct in mammalian cellsDepositorInsertHPS4 (HPS4 Human)
Tags3xMyc tagExpressionMammalianMutationGlutamic acid 229 to Glycine; Valine 552 to Methi…PromoterCMV I.E.Available SinceNov. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DYRK1A-2A-GFP
Plasmid#118270PurposeExpresses mouse DYRK1A tagged with 2A peptide at it's C-terminus and GFP in mammalian cells.DepositorInsertdual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1a (Dyrk1a Mouse)
UseAAVTags2A peptide and GFPExpressionMammalianPromoterCMV with beta global intronAvailable SinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
8xNFAT-ZsG-muhCD4
Plasmid#162745PurposeNFAT-driven ZsGreen-1 reporter gene with mutated human CD4 geneDepositorInsert8x of NFAT binding motif follwed by ZsGreen-1 fluorescent protein gene (CD4 Human)
UseRetroviralExpressionMammalianMutationHuman CD4 gene with glutamine to tyrosine at posi…Available SinceApril 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xEcoLeuT(CUA)_AnapRS
Plasmid#140019PurposePlasmid with 4xEcoLeuT(CUA) cassette and E. coli AnapRS for amber suppression and incorporation of the fluorescent ncAA Anap; for transient or stable piggyBac-mediated integrationDepositorInsertEcoLeuRS (AnapRS)
ExpressionMammalianMutationL38F, M40G, L41P, Y499V, Y500L, Y527A, H537E, L53…PromoterEF1Available SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDEST53-LRRK2-Y1699C
Plasmid#25048DepositorAvailable SinceJune 17, 2010AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1A-LivePAR(Y107A)-Hygro
Plasmid#176073PurposeEGFP fused to the C-terminus of a WWE domain containing the mutation Tyr107Ala & a hygromycin resistance cassetteDepositorInsertLivePAR (Y107A)
UseLentiviralTagsEGFPExpressionMammalianMutationPoint mutation to convert Try107 to AlaPromoterEF1AAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLVX-CLK1
Plasmid#174088PurposeInducibly expresses Myc-CLK1 in mammalian cells with the Tet-on systemDepositorAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCOTS-pyl-GFP(35TAG)
Plasmid#92047PurposeThis is a S. elongatus (PCC7942) cyanobacterial plasmid that encodes the pylRS orthogonal translation system. In addition it encodes for a GFP reporter with TAG mutation at site 35.DepositorInsertsEGFP
Pyrrolysyl tRNA(cua)
Pyrrolysyl tRNA synthetase (methanosarcina mazei)
UseReplicative expression plasmid for cyanobacteria …TagsHistagMutationTyrosine in position 35 of the GFP was mutated f…PromoterLeuP (native S. elongatus promoter), PpsbII, and …Available SinceOct. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
Tet-myr-CSK K222R-GFP
Plasmid#83471PurposeLentiviral vector for doxycycline-inducible expression of membrane targeted kinase dead CSK in mammalian cellsDepositorInsertCSK (CSK Human)
UseLentiviralTagsEGFPExpressionMammalianMutationK222R (kinase dead)Promoterdoxycycline-inducible promoterAvailable SinceOct. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DIO-trkB.DN-mCherry
Plasmid#121502PurposeExpresses trkB.T1 fused with mCherry in a cre dependent manner.DepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only