We narrowed to 1,760 results for: zan
-
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQCXIZ GFP PODXL delta PBM
Plasmid#202415PurposeExpression of GFP-tagged PODXL PDZ-binding motif mutation (PBM; doesn't bind NHERF1/2)DepositorAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQCXIZ GFP PODXL FBM
Plasmid#202417PurposeExpression of GFP-tagged PODXL FERM-binding motif mtuation (FBM; doesn't bind Ezrin)DepositorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-RDH11
Plasmid#161924PurposeTo generate RDH11 KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against RDH11 exon 2.DepositorInsertsgRNA targeting RDH11 exon 2
UseCRISPRExpressionMammalianPromoterU6Available SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Y478C-WLS-HA-IRES-GFP
Plasmid#178063PurposeExpression of WLS-HA protein (Y478C mutant)DepositorAvailable SinceJan. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Y392C-WLS-HA-IRES-GFP
Plasmid#178062PurposeExpression of WLS-HA protein (Y392C mutant)DepositorAvailable SinceJan. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-I531T-WLS-HA-IRES-GFP
Plasmid#178064PurposeExpression of WLS-HA protein (I531T mutant)DepositorAvailable SinceJan. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pWZL Neo Myr Flag GK2
Plasmid#20494DepositorAvailable SinceOct. 27, 2009AvailabilityAcademic Institutions and Nonprofits only -
pBabe-Puro-BRAF-V600E
Plasmid#15269PurposeRetroviral expression of BRAF V600E (the V600E mutation has been found in cancer patients, confers increased kinase activity, and is transforming)DepositorInsertBRAF (BRAF Human)
UseRetroviralTagsHis and MycExpressionMammalianMutationValine 600 to Glutamate (mutation has been found …Available SinceJuly 12, 2007AvailabilityAcademic Institutions and Nonprofits only -
pWZL Neo Myr Flag BTK
Plasmid#20432DepositorAvailable SinceOct. 27, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCSC-NGN2-IRES-GFP-T2A-Sox11
Plasmid#90214PurposeTo convert human skin fibroblasts into induced motor neurons (hiMN) in combination with ISL1, LHX3, FGF2 and two small molecules, forskolin and dorsomorphin.DepositorAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-HPGD-FLAGC
Plasmid#161915PurposeExpresses human HPGD with a C-terminal FLAG-GFP tag. Confers G418 resistance.DepositorAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-AAV.CAP-Mac
Plasmid#200658PurposeSynthetic construct isolate AAV.CAP-Mac VP1 geneDepositorInsertSynthetic construct isolate AAV.CAP-Mac VP1 gene
UseAAVExpressionMammalianMutation7 amino acid insertion after Q588 of the AAV9 CAP…Promoterp41Available SinceAug. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLENTI_hACE2_HygR
Plasmid#155296PurposeLentiviral vector to generate hACE2 stable expressing cell line, Hygromycin resistanceDepositorAvailable SinceAug. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pWZL Neo Myr Flag GRK5
Plasmid#20495DepositorAvailable SinceOct. 27, 2009AvailabilityAcademic Institutions and Nonprofits only -
pWZL Neo Myr Flag BEGAIN
Plasmid#20567DepositorAvailable SinceOct. 27, 2009AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-FLAG-BRAT1
Plasmid#161920PurposeExpresses human BRAT1 with a N-terminal GFP-FLAG tag. Confers G418 resistance.DepositorInsertBRCA1-associated ATM activator 1 (BRAT1 Human)
TagsGFP-FLAGExpressionMammalianPromoterCMVAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pWZL Neo Myr Flag MAST1
Plasmid#20532DepositorAvailable SinceOct. 27, 2009AvailabilityAcademic Institutions and Nonprofits only -
pWZL Neo Myr Flag ADRBK1
Plasmid#20418DepositorAvailable SinceOct. 27, 2009AvailabilityAcademic Institutions and Nonprofits only