-
Plasmid#185131PurposeSwi6 full length with L->A mutated in nuclear localization signalDepositorInsertSWI6
UseTagsGFPExpressionYeastMutationSWI6 deletion of amino acids 450-458PromoterAvailable sinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB556
Plasmid#185108Purpose1st 200 amino acids (N-term + transmembrane domain) of Pom152 fused to HA and GFP with S158A, F159A, F160ADepositorInsertPOM152
UseTagsGFPExpressionYeastMutation1st 200 amino acids (N-term + transmembrane domai…PromoterAvailable sinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB553
Plasmid#185107Purpose1st 200 amino acids (N-term + transmembrane domain) of Pom152 fused to HA and GFP with Y180L, Q182LDepositorInsertPOM152
UseTagsGFPExpressionYeastMutation1st 200 amino acids (N-term + transmembrane domai…PromoterAvailable sinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB439
Plasmid#185093PurposeNMA111-GFP wild type under control of GAL1 promoter (complements nma111 deletion)DepositorInsertNMA111
UseTagsGFPExpressionYeastMutationGAL1::NMA111-GFPPromoterGAL1Available sinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB345
Plasmid#185078Purposerfa3D46 truncation fused to GFPDepositorInsertRFA3
UseTagsGFPExpressionYeastMutationRfa3 truncation aa 1-46PromoterAvailable sinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB419
Plasmid#185089PurposeSwi6L-GFP expressing N-term 273 amino acids of Swi6DepositorInsertSWI6
UseTagsGFPExpressionYeastMutationSwi6 truncation at aa 273PromoterAvailable sinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB462
Plasmid#185095PurposeNMA111-GFP with NLS1 and NLS2 mutated under control of GAL1 promoterDepositorInsertNMA111
UseTagsGFPExpressionYeastMutationGAL1::nma111Dnls1Dnls2-GFPPromoterGAL1Available sinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB354
Plasmid#185082PurposeSwi6L-GFP expressin N-term 273 amino acids of Swi6DepositorInsertSWI6
UseTagsGFPExpressionYeastMutationSwi6 truncation aa 1-273PromoterAvailable sinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB416
Plasmid#185087PurposeSwi6L-GFP with nuclear export signal mutated to alaninesDepositorInsertSWI6
UseTagsGFPExpressionYeastMutationSwi6 nuclear export signal L to A mutationsPromoterAvailable sinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB394
Plasmid#185086PurposeNMA111 with both nuclear localization signals mutated to alanines fused to GFP (mutagenesis of KBB280)DepositorInsertNMA111
UseTagsGFPExpressionYeastMutationNma111 KKR 9-11 AAA; KRK 28-30 AAAPromoterAvailable sinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB349
Plasmid#185080Purposerfa2D248 truncation fused to GFPDepositorInsertRFA2
UseTagsGFPExpressionYeastMutationRfa2 truncation aa 1-247PromoterAvailable sinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB353
Plasmid#185081PurposeSwi6M-GFP expressing N-term 181 amino acids of Swi6DepositorInsertSWI6
UseTagsGFPExpressionYeastMutationSwi6 truncation aa 1-181PromoterAvailable sinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB484
Plasmid#185132PurposeSWI6-GFP full length under control of GAL1 promotionDepositorInsertSWI6
UseTagsGFPExpressionYeastMutationPromoterAvailable sinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-psbA2 point mutation
Plasmid#182929Purposepoint mutation on psbA2 by CRISPR in Synechocystis 6803DepositorInsertsddcpf1
gRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc
psbA
UseCRISPRTagsExpressionMutationS264A, and silent mutation to remove PAM sitePromoterAvailable sinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ecm2 1-197
Plasmid#169924PurposeWT Ecm2 mutated to introduce stop codon after AA 197 of Ecm2DepositorInsertEcm2 1-197
UseTagsExpressionBacterial and YeastMutationPromoterAvailable sinceOct. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBHRSF228
Plasmid#135007PurposeMusF2 prenyltransferases from Nostoc sp. UHCC 0398DepositorInsertMusF2 prenyltransferase
UseTagsExpressionBacterialMutationPromoterAvailable sinceSept. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
VanR - F165V
Plasmid#158965PurposeWild type VanR where the residue in position 165 was mutated from Phenylalanine to Valine. This mutation abolished the response to vanillic acid. The gene is under the control of the TEF1 promoter.DepositorInsertVanR - F165V
UseTagsExpressionYeastMutationWild type VanR from Caulobacter crescentus with m…PromoterTEF1Available sinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
VanR - F165R
Plasmid#158966PurposeWild type VanR where the residue in position 165 was mutated from Phenylalanine to Arginine. This mutation abolished the response to vanillic acid. The gene is under the control of the TEF1 promoter.DepositorInsertVanR - F165R
UseTagsExpressionYeastMutationWild type VanR from Caulobacter crescentus with m…PromoterTEF1Available sinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMP89b CvTA V124N
Plasmid#141207PurposeChromobacterium violaceum transaminase with enhances affinity for PLP. TEV cleaving site after the N-terminal Histag.DepositorInsertCvTA
UseTagsExpressionBacterialMutationV124NPromoterAvailable sinceJune 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHBDuet139
Plasmid#121913PurposeCharge-Introduced NpuDnaB mini-inteinDepositorInsertCI-NpuDnaBΔ290 intein
UseTagsGB1 and His6-GB1ExpressionBacterialMutationDeletion of 290-residue endonuclease domain, I53K…PromoterT7Available sinceDec. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHBDuet140
Plasmid#121914PurposeOrthogonal NpuDnaB mini-intein inteinDepositorInsertOth-NpuDnaBΔ290 intein
UseTagsGB1 and His6-GB1ExpressionBacterialMutationDeletion of 290-residue endonuclease domain, I53K…PromoterT7Available sinceDec. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMET17p-CCG 316
Plasmid#131166PurposeFor ScMET17 promoter regulated expression of mCherry-Cub-R-GFP (CCG) fused bait proteins, centromeric ARS plasmid, URA3 complements the uracil auxotrophy of S. cerevisiae ura mutantDepositorTypeEmpty backboneUseTagsCCGExpressionYeastMutationPromoterAvailable sinceSept. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
Spt2-K166R-GFP
Plasmid#115573PurposeExpresses yeast Spt2-GFP fusion protein mutated from lysine to arginine at site 166DepositorInsertSPT2
UseTagsGFPExpressionBacterial and YeastMutationLysine 166 mutated to ArgininePromoterAvailable sinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
GFP-X2
Plasmid#115567PurposeGFP tethered to two repeats of the Gcn5 consensus motifDepositorInsertGreen Fluorescent Protein
UseTagsExpressionBacterial and YeastMutationTwo repeats of the Gcn5 consensus motif are tagge…PromoterADH1Available sinceOct. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
GFP-X1
Plasmid#115566PurposeGFP tethered to a single repeat of the Gcn5 consensus motifDepositorInsertGreen Fluorescent Protein
UseTagsExpressionBacterial and YeastMutationSingle Gcn5 consensus motif repeat tethered to C-…PromoterADH1Available sinceOct. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
Hsh155 N4A 3xFLAG
Plasmid#111975PurposeShuffle plasmid containing the HSH155 gene and surrounding regions. It bears a TRP marker. It has 3xFLAG at the C-terminus. Contains the N4A mutation.DepositorInsertHsh155 N4A 3x FLAG
UseTags3xFLAGExpressionBacterial and YeastMutationT178A R181A R182A R186APromoterAvailable sinceJune 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
Hsh155 K818A 3xFLAG
Plasmid#111982PurposeShuffle plasmid containing the HSH155 gene and surrounding regions. It bears a TRP marker for shuffle into a HSH155 deletion strain. It has 3xFLAG at the C-terminus. Contains K818A mutation. LethalDepositorInsertHsh155 K818A 3x FLAG
UseTags3xFLAGExpressionBacterial and YeastMutationK818APromoterAvailable sinceJune 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
Hsh155 R775A 3xFLAG
Plasmid#111977PurposeShuffle plasmid containing the HSH155 gene and surrounding regions. It bears a TRP marker for shuffle into a HSH155 deletion strain. It has 3xFLAG at the C-terminus. Contains R775A mutation. LethalDepositorInsertHsh155 R775A 3x FLAG
UseTags3xFLAGExpressionBacterial and YeastMutationR775APromoterAvailable sinceJune 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
Hsh155 R778A 3xFLAG
Plasmid#111979PurposeShuffle plasmid containing the HSH155 gene and surrounding regions. It bears a TRP marker for shuffle into a HSH155 deletion strain. It has 3xFLAG at the C-terminus. Contains R778A mutation. LethalDepositorInsertHsh155 R778A 3x FLAG
UseTags3xFLAGExpressionBacterial and YeastMutationR778APromoterAvailable sinceJune 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTCW022
Plasmid#83532Purposepheromone mediated expression of UBiC, ARO4, and TKL1DepositorInsertpFUS1J2-UBiC-CYC1t-pFUS1J2-ARO4*-CYC1t-pFUS1J2-TKL1-CYC1t
UseTagsExpressionYeastMutationPromoterpFUS1J2Available sinceDec. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTCW015
Plasmid#83530PurposeUBiC and feedback resistant ARO4 expression from pheromone inducible FUS1J2 promoterDepositorInsertpFUS1J2-UBiC-CYC1t-pFUS1J2-ARO4*-CYC1t
UseTagsExpressionYeastMutationPromoterpFUS1J2Available sinceDec. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
PHBA03
Plasmid#83537PurposeConstitutive TEF1 promoter mediated expression of the UBiC, ARO4*, and TKL1 genesDepositorInsertpTEF1-UBiC-CYC1t-pTEF1-ARO4*-CYC1t-pTEF1-TKL1-CYC1t
UseTagsExpressionYeastMutationPromoterpTEF1Available sinceDec. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDA186
Plasmid#74250PurposeIntermediate cloning vector, with MCS2 containing inducible unstable peptide driven by pGPD1 (UbiY 2xNLSs SZ3).DepositorInsertInducible peptide of the dPSTR
UseTagsExpressionBacterial and YeastMutationPromoterpGPD1Available sinceMay 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDA171
Plasmid#74251PurposeIntermediate cloning vector, with MCS2 containing inducible stable peptide driven by pSTL1 (Venus 2xNLSs SZ1).DepositorInsertInducible peptide of the dPSTR
UseTagsVenusExpressionBacterial and YeastMutationPromoterpSTL1Available sinceMay 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
HI.HslU(delI)V.RSET.wt(Nde1).107-GG-244
Plasmid#17859DepositorInsertHaemophilus influenzae heat shock loci U and V
UseTagsExpressionBacterialMutationcoding sequence for residues 108-243 of HslU (the…PromoterAvailable sinceMay 29, 2008AvailabilityAcademic Institutions and Nonprofits only -
pJLI-Sup35N-KDG6-C
Plasmid#1238DepositorInsertSUP35 (SUP35 Budding Yeast)
UseYeast integrative plasmidTagsExpressionMutationSUP35 middle region (aa124-253) was replaced with…PromoterAvailable sinceJan. 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
Ecm2 1-143
Plasmid#169923PurposeWT Ecm2 mutated to introduce stop codon after AA 143 of Ecm2DepositorInsertEcm2 1-143
UseTagsExpressionBacterial and YeastMutationPromoterAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
Ecm2 1-265
Plasmid#169925PurposeWT Ecm2 mutated to introduce stop codon after AA 265 of Ecm2DepositorInsertEcm2 1-265
UseTagsExpressionBacterial and YeastMutationPromoterAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
Ecm2 1-325
Plasmid#169926PurposeWT Ecm2 mutated to introduce stop codon after AA 325 of Ecm2DepositorInsertEcm2 1-325
UseTagsExpressionBacterial and YeastMutationPromoterAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
pMXs-IP HA-Parkin
Plasmid#38248DepositorInsertParkin (PRKN Human)
UseRetroviralTagsHAExpressionMammalianMutationPromoterAvailable sinceAug. 16, 2012AvailabilityAcademic Institutions and Nonprofits only -
siRNA-resistant SigmaR1-mCherry
Plasmid#226567PurposeEncodes siRNA resistant SigmaR1 protein labeled with mCherryDepositorInsertSigmaR1 (Sigma-1 Receptor) (SIGMAR1 Human)
UseTagsmCherryExpressionMammalianMutationPromoterAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
siRNA-resistant pLV-SigmaR1-mNeonGreen
Plasmid#226569PurposeEncodes siRNA resistant SigmaR1 protein labeled with mNeonGreen (lentiviral vector)DepositorInsertSigmaR1 (Sigma-1 Receptor) (SIGMAR1 Human)
UseLentiviralTagsmNeonGreenExpressionMutationPromoterAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pZS157 CRISPEY RT/Cas9
Plasmid#114454PurposeYeast Integration Plasmid for galactose inducible Ec86-RT and SpCas9 expressionDepositorInsertSpCas9, Ec86-RT
UseCRISPRTagsSV40-NLSExpressionYeastMutationS. cerevisiae codon optimizedPromoterGAL1-GAL10Available sinceOct. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
CFP-Parkin
Plasmid#47560PurposeCFP tagged Parkin for colocalization studyDepositorInsertParkin (PRKN Human)
UseTagsCFPExpressionMammalianMutationPromoterCMVAvailable sinceSept. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMK419 (GAL-OsTIR1(F74G))
Plasmid#140656PurposeGAL-OsTIR1(F74G)DepositorInsertGAL-OsTIR1(F74G)
UseTagsExpressionYeastMutationPromoterAvailable sinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
mCherry-Parkin
Plasmid#23956PurposeMammalian expression of human Park2 fused to mCherryDepositorInsertPark2 (PRKN Human)
UseTagsmCherryExpressionMammalianMutationPromoterAvailable sinceMarch 24, 2010AvailabilityAcademic Institutions and Nonprofits only -
pCRCT
Plasmid#60621PurposePlasmid encoding iCas9, tracrRNA and crRNAsDepositorInsertsiCas9
tracrRNA
UseCRISPRTagsFLAG and SV40 NLSExpressionYeastMutationchanged Aspartate 147 to Tyrosine, Proline 411 to…PromoterRPR1p and TEF1pAvailable sinceOct. 31, 2014AvailabilityAcademic Institutions and Nonprofits only -
p415-PtrpC-Cas9-TtrpC-CYC1t
Plasmid#68059PurposeExpress humanized Cas9 under the control of trpC promoter and terminator from A. nidulans.DepositorInserthumanized Cas9
UseCRISPR; N. crassa, fungiTagsExpressionYeastMutationPromoterAvailable sinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHAGE PGK-GFP-IRES-LUC-W
Plasmid#46793Purpose2nd generation lentiviral vectorDepositorInsertsUseLentiviralTagsExpressionMutationPromoterAvailable sinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only