We narrowed to 2,606 results for: EXO
-
Plasmid#172826PurposeMammalian expression of a sgRNA targeting the intron 1 position 2 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the intron 1 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-EGxxFP-PIGA
Plasmid#153958PurposeUsed for EGxxFP assay with PIGA intron 5 and exon 6 sequencesDepositorInsertPIGA (a 401-bp fragment from intron 5 and exon 6)
UseA plasmid specific for egxxfp assayTagsN/AExpressionMammalianMutationNo mutationPromoterCAG promoterAvailable SinceDec. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-EGxxFP-CD55
Plasmid#153959PurposeUsed for EGxxFP assay with CD55 intron 3, exon 4, and intron 4 sequencesDepositorInsertCD55 (a 1,016-bp fragment from intron 3, exon 4, and intron 4)
UseA plasmid specific for egxxfp assayTagsN/AExpressionMammalianMutationNo mutationPromoterCAG promoterAvailable SinceDec. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCI-Neo-p53mut
Plasmid#99239PurposeMutant p53 encoded by AS-30D rat hepatoma cell lineDepositorInsertp53 (Tp53 Rat)
ExpressionMammalianMutationSilent mutations in translated protein at Gly (10…PromoterCMV immediate/early enhancer/promoterAvailable SinceAug. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-SPA mimic WT
Plasmid#92350PurposeTo mimic SPA RNA processing and expressionDepositorInsertSNRPN exon 9, intron9, exon10, intron10 partial partial of SPA1 (SNRPN Human)
ExpressionMammalianPromoterCMVAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
Hy_pMT Laccase2 MCS-Laccase2 608-1097
Plasmid#69890PurposeExpresses the Drosophila laccase2 exon 2 circular RNADepositorInsertLaccase2 (stw Fly)
ExpressionInsectMutationL158I in laccase2PromoterMetallothionein Promoter (pMT)Available SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMA3411
Plasmid#46877PurposeA retroviral vector for the constitutive expression of soluble guanylate cyclase1 beta3 double mutant (E473K and C541D)DepositorInsertsoluble guanylate cyclase1 beta 3 (Gucy1b3 Rat)
UseRetroviralMutationE473K, C541DPromoterLTRAvailable SinceAug. 14, 2013AvailabilityIndustry, Academic Institutions, and Nonprofits -
p414GPD-3xFLAG-Nop4 dE5
Plasmid#169263PurposeS. cerevisiae (yeast) vector for constitutive expression of 3xFLAG-Nop4 delta Exon 5DepositorInsertNop4 delta E5 (NOP4 Budding Yeast)
Tags3xFLAGExpressionYeastMutationdeleted region corresponding to human Exon 5PromoterGPDAvailabilityAcademic Institutions and Nonprofits only -
p414GPD-3xFLAG-Nop4 dE8
Plasmid#169264PurposeS. cerevisiae (yeast) vector for constitutive expression of 3xFLAG-Nop4 delta Exon 8DepositorInsertNop4 delta E8 (NOP4 Budding Yeast)
Tags3xFLAGExpressionYeastMutationdeleted region corresponding to human Exon 8PromoterGPDAvailabilityAcademic Institutions and Nonprofits only -
p414GPD-3xFLAG-RBM28 dE5
Plasmid#169267PurposeS. cerevisiae (yeast) vector for constitutive expression of 3xFLAG-RBM28 delta Exon 5DepositorInsertRBM28 delta E5 (RBM28 Human)
Tags3xFLAGExpressionYeastMutationdeleted Exon 5PromoterGPDAvailabilityAcademic Institutions and Nonprofits only -
p414GPD-3xFLAG-RBM28 dE8
Plasmid#169268PurposeS. cerevisiae (yeast) vector for constitutive expression of 3xFLAG-RBM28 delta Exon 8DepositorInsertRBM28 delta E8 (RBM28 Human)
Tags3xFLAGExpressionYeastMutationdeleted Exon 8PromoterGPDAvailabilityAcademic Institutions and Nonprofits only -
pCDNA_MET_D14_3Flag
Plasmid#182495PurposeContains cDNA of the MET gene without the exon 14DepositorAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
polyQ74-GFP
Plasmid#231893PurposeForms cytosolic HTT partial exon 1 Q74 aggregatesDepositorInsertHTT partial exon 1 Q74 (HTT Human)
TagsEGFPExpressionMammalianMutationCAG repeat expansionAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
EPS15-GFP-His
Plasmid#170860PurposeMammalian expression of EPS15-GFP-His.DepositorInsertEpidermal growth factor receptor pathway substrate 15 (EPS15) (EPS15 Human)
Tags(His)6 and EGFPExpressionMammalianPromoterCMVAvailable SinceJune 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA1-Tat
Plasmid#138478PurposeExpresses HIV Tat for efficient sgRNA packaging.DepositorInsertTat
ExpressionMammalianAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ shcGAS-Hsa
Plasmid#128175PurposeDoxycyclin inducible shRNA knockdown of human cGAS geneDepositorAvailable SinceOct. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
GFP-polyQ23-NLS
Plasmid#231891PurposeExpression of non-aggregated HTT partial exon 1 Q23-NLS in the nucleusDepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
SuExp-hPLD3
Plasmid#201243Purposeexpress full length human PLD3 proteinDepositorAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pASK-mSAN1-Streptag
Plasmid#117165PurposeExpresses Strep-tagged murine SAN1 nuclease in bacteriaDepositorAvailable SinceOct. 22, 2018AvailabilityAcademic Institutions and Nonprofits only