We narrowed to 4,220 results for: PRS
-
Plasmid#101886PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable SinceApril 30, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits
-
pSG75-β2AR-T4L-sfGFP
Plasmid#102461PurposeExpresses a fusion protein of β2 adrenergic receptor/T4 lysozyme chimera and sfGFP with a C-terminal His tag. The expression is controlled by a OR2-OR1-Pr promoter.DepositorArticleInsertβ2AR
TagsHis tag and sfGFPExpressionBacterialPromoterOR2-OR1-PrAvailable SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSG74-β2AR-sfGFP
Plasmid#102460PurposeExpresses a fusion protein of wild type β2 adrenergic receptor and sfGFP with a C-terminal His tag. The expression is controlled by a OR2-OR1-Pr promoter.DepositorArticleInsertβ2AR
TagsHis tag and sfGFPExpressionBacterialPromoterOR2-OR1-PrAvailable SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
p201N 1509
Plasmid#55768PurposeContains soybean miRNA miR1509 recognition sequence (CAACCTTGATTTCCTTGATTAA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceSept. 8, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJP_Ctrl10
Plasmid#219672PurposeContains PT3lacO promoter (regulated by blue light and LacI) controlling the expression of mCherry. LacI is constitutively produced by pR promoter.DepositorInsertsmCherry
lacI
PromoterPT3lacO and pRAvailable SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSG73-β1ARts-sfGFP
Plasmid#102459PurposeExpresses a fusion protein of thermostabilized β1 adrenergic receptor and sfGFP with a C-terminal His tag. The expression is controlled by a OR2-OR1-Pr promoter.DepositorArticleInsertβ1AR
TagsHis tag and sfGFPExpressionBacterialPromoterOR2-OR1-PrAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
p201N 1510a.2
Plasmid#55770PurposeContains soybean miRNA miR1510a.2 recognition sequence (ATGGGTGGAATAGGGAAAACAA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceOct. 23, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
p201N 5770
Plasmid#55772PurposeContains soybean miRNA miR5770 recognition sequence (TCTTGTCCAAACCATAGTCCAA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceSept. 26, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
p201N 1510
Plasmid#55771PurposeContains soybean miRNA miR1510 recognition sequence (AGGTGGAATAGGAAAAACAACT) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceSept. 26, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
p201N 3514
Plasmid#55769PurposeContains soybean miRNA miR3514 recognition sequence (AAGGTCTCTGTCTTAATGGTGA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceAug. 21, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
ILID-CAAX
Plasmid#85680PurposeExpression of untagged ILID CAAXDepositorInsertILID-CAAX
ExpressionMammalianPromoterCMVAvailable SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPAP002
Plasmid#153489PurposeLevel 1 episomal expression plasmid for P. pastorisDepositorTypeEmpty backboneExpressionYeastAvailable SinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPAP001
Plasmid#153488PurposeLevel 1 episomal expression plasmid for P. pastorisDepositorTypeEmpty backboneExpressionYeastAvailable SinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-AktAR2
Plasmid#64932PurposeEnhanced FRET-based biosensor for monitoring Akt activity.DepositorInsertAktAR2
TagsCerulean3 and cpVenus[E172]ExpressionMammalianPromoterCMVAvailable SinceJuly 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
p201G Cas9
Plasmid#59178PurposeCas9 driven by double 35S, GFP for plant selection, I-PpoI site to accept gRNA from pUC gRNA ShuttleDepositorInsertsCas9
sGFP
UseCRISPRPromoter2x35SAvailable SinceSept. 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
pVP144
Plasmid#222081PurposeSingle component CRISPR-mediated base-editor for Agrobacterium genetic engineering visually marked with sfGFP for guide insertion and eforRED for plasmid eviction.DepositorInsertdCas9-PmCDA1, sfGFP, sacB and eforRED
UseCRISPRExpressionBacterialAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVP143
Plasmid#222080PurposeSingle component CRISPR-mediated base-editor for Agrobacterium genetic engineering visually marked with sfGFP for guide insertion and AeBlue for plasmid eviction.DepositorInsertdCas9-PmCDA1, sfGFP, sacB and AeBlue
UseCRISPRExpressionBacterialAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
MCS Lck only
Plasmid#90411PurposeA control of MCS+ that associated with cell plasma membrane only by one hydrophobic interaction at the N terminus of the FRET pair.DepositorInsertLck10+ Venus+mcherry
ExpressionMammalianAvailable SinceMay 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pVP141
Plasmid#222079PurposeSingle component CRISPR-mediated base-editor for Agrobacterium genetic engineering visually marked with sfGFP for guide insertion.DepositorInsertdCas9-PmCDA1, sfGFP and sacB
UseCRISPRExpressionBacterialAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
MCS+
Plasmid#90412PurposeA FRET sensor that report the electric potential at the inner leaflet of cell plasma membraneDepositorInsertLck10+ Venus+mcherry+ strech of positively charged amino acids
ExpressionMammalianAvailable SinceMay 24, 2017AvailabilityAcademic Institutions and Nonprofits only