We narrowed to 4,275 results for: PRS
-
Plasmid#173487PurposeExpresses spNW80 in Bl21DepositorInsertspNW80
TagsHistagExpressionBacterialAvailable SinceSept. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVP077
Plasmid#222029PurposeEmpty Kanamycin resistant GreenGate destination vector based on pGGP-AG. Domesticated of Esp3I sites in the backbone and chloramphenicol resistance gene.DepositorTypeEmpty backboneUseSynthetic Biology; Greengate compatible cloning v…MutationAll Esp3i sites domesticatedAvailable SinceDec. 16, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSG66-KcsA-Kv1.3-sfGFP
Plasmid#102457PurposeExpresses a fusion protein of KcsA-Kv1.3 and sfGFP with a C-terminal His tag. The expression is controlled by a OR2-OR1-Pr promoter.DepositorArticleInsertKcsA-Kv1.3
TagsHis tag and sfGFPExpressionBacterialPromoterOR2-OR1-PrAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLO86
Plasmid#91724Purposemycobacterial expression of mCherry reporterDepositorTypeEmpty backboneUseUnspecified; Mycobacterial expressionTagsmCherryAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pVP293
Plasmid#222062PurposeGreenGate CD bridge module containing filler sequence, backbone domesticated of Esp3I sites.DepositorInsertFiller
UseSynthetic Biology; Greengate compatible cloning v…MutationBackbone Esp3i sites have been domesticatedAvailable SinceDec. 16, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pVP294
Plasmid#222063PurposeGreenGate DE bridge module containing filler sequence, backbone domesticated of Esp3I sites.DepositorInsertFiller
UseSynthetic Biology; Greengate compatible cloning v…MutationBackbone Esp3i sites have been domesticatedAvailable SinceDec. 16, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pVP096
Plasmid#222043PurposepGGPK-AG2 where the ccdb/CmR has been swappe for mRFP1e; Esp3I domesticated backbone.DepositorInsertmRFP1e
UseSynthetic Biology; Greengate compatible cloning v…Available SinceDec. 16, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pVP076
Plasmid#222028PurposeEmpty spectinomycin resistant GreenGate destination vector based on pGGP-AG. Domesticated of Esp3I sites in the backbone and chloramphenicol resistance gene.DepositorTypeEmpty backboneUseSynthetic Biology; Greengate compatible cloning v…MutationAll Esp3i sites domesticatedAvailable SinceDec. 16, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJP_Ctrl10
Plasmid#219672PurposeContains PT3lacO promoter (regulated by blue light and LacI) controlling the expression of mCherry. LacI is constitutively produced by pR promoter.DepositorInsertsmCherry
lacI
PromoterPT3lacO and pRAvailable SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
spNW100
Plasmid#173488PurposeExpresses spNW100 in Bl21DepositorInsertspNW100
TagsHistagExpressionBacterialMutationP1049L- please see depositor commentsPromoterT7Available SinceSept. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC-TALO8
Plasmid#83409PurposeTRP1-ARS1-8xLacO (TALO8) minichromosome system for histone purification in yeastDepositorInsertTRP-ARS-8xLacO
ExpressionYeastMutationPlease see depositor comments belowPromoterTRP1Available SinceNov. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLO87
Plasmid#91726Purposemycobacterial expression of mCherry from Hsp60 promoterDepositorInserthsp60 promoter
UseMycobacterial expressionTagsmCherryPromoterhsp60Available SinceMay 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
5T5G (SETD8)
Plasmid#101886PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable SinceApril 30, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSG75-β2AR-T4L-sfGFP
Plasmid#102461PurposeExpresses a fusion protein of β2 adrenergic receptor/T4 lysozyme chimera and sfGFP with a C-terminal His tag. The expression is controlled by a OR2-OR1-Pr promoter.DepositorArticleInsertβ2AR
TagsHis tag and sfGFPExpressionBacterialPromoterOR2-OR1-PrAvailable SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSG74-β2AR-sfGFP
Plasmid#102460PurposeExpresses a fusion protein of wild type β2 adrenergic receptor and sfGFP with a C-terminal His tag. The expression is controlled by a OR2-OR1-Pr promoter.DepositorArticleInsertβ2AR
TagsHis tag and sfGFPExpressionBacterialPromoterOR2-OR1-PrAvailable SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
p201N 1509
Plasmid#55768PurposeContains soybean miRNA miR1509 recognition sequence (CAACCTTGATTTCCTTGATTAA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceSept. 8, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSG73-β1ARts-sfGFP
Plasmid#102459PurposeExpresses a fusion protein of thermostabilized β1 adrenergic receptor and sfGFP with a C-terminal His tag. The expression is controlled by a OR2-OR1-Pr promoter.DepositorArticleInsertβ1AR
TagsHis tag and sfGFPExpressionBacterialPromoterOR2-OR1-PrAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
p201N 1510a.2
Plasmid#55770PurposeContains soybean miRNA miR1510a.2 recognition sequence (ATGGGTGGAATAGGGAAAACAA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceOct. 23, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
p201N 5770
Plasmid#55772PurposeContains soybean miRNA miR5770 recognition sequence (TCTTGTCCAAACCATAGTCCAA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceSept. 26, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
p201N 1510
Plasmid#55771PurposeContains soybean miRNA miR1510 recognition sequence (AGGTGGAATAGGAAAAACAACT) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceSept. 26, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits