We narrowed to 6,915 results for: tac
-
Plasmid#85224PurposeshLuc (Target TTACGCTGAGTACTTCGA) for silencing luciferase gene as a control and express monomeric Kusabira-Orange2.DepositorInsertFirefly Luciferase
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3/FKBP12-pBirA(284-C)-HA
Plasmid#154452Purposeexpresses FKBP12-pBirA(284-C)-HA/biochemical assayDepositorAvailable SinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTS2322
Plasmid#169627PurposeTier-2 co-expression vector encoding PhCMV-driven SEAP coupled to fluorescent reporter iRFP670 and PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 that is insulated via a 5' Tactb insulator sequence (PhCMV-SEAP-p2A-iRFP670-pA::Tactb-PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA::A3-pA).DepositorInsertPCMV-driven expression of SEAP and iRFP and Tactb-modulated PPGK-driven expression of secreted Nluc and mTagBFP2
ExpressionMammalianPromoterPhCMV / PPGKAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_MDM4_exon_deletion_1
Plasmid#155073PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3/flag-pbira(1-g78)-sec61b
Plasmid#154455Purposeexpresses flag-pbira(1-g78)-sec61b/biochemical assayDepositorAvailable SinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5/avitag-apex2-v5-fkbp8
Plasmid#154460Purposeexpresses avitag-apex2-v5-fkbp8/biochemical assayDepositorAvailable SinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRetroX SgK269 WT
Plasmid#68028Purposeexpression of Sgk269 in mammalian cellsDepositorAvailable SinceNov. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
sg_Trp53_i4-ipUSEPR-TR657
Plasmid#228930PurposeKnockdown of Trp53 in mammalian cellsDepositorInsertsg_Trp53_i4 (Trp53 Mouse, sequence: GTCGCTACCTACAGCCAGGA)
UseLentiviralAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_4
Plasmid#155062PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and three intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and three intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFlare9A-Clip2E9 Mutant
Plasmid#209575Purposeminigene construct for Clip2 E9 alternative splicing, potential PTBP2 binding sites are deletedDepositorInsertClip2 (Clip2 Mouse)
ExpressionMammalianMutationACGCGTTTCTGAATTCTTCTAACTGCCCTCAAATGCACGGTGGCATGTG…PromoterCMVAvailable SinceMarch 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shCALM2-1
Plasmid#193699PurposeConstitutive lentiviral expression of CALM2 shRNADepositorInsertCALM2 (CALM2 Human)
UseLentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry-Rorb sesRNA-2a-msFlag-2a-tTA2-WPRE
Plasmid#239029PurposeExpression of mCherry, sesRNA in mammalian cells, with msFlag and tTA2 as efRNA.DepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry-Satb2 sesRNA-2a-msFlag-2a-tTA-WPRE
Plasmid#239028PurposeExpression of mCherry, sesRNA in mammalian cells, with msFlag and tTA2 as efRNA.DepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
Adeno FT
Plasmid#101824PurposeAdenovirus for the expression of gRNAs targeting intron 17 of murine Fgfr3 and intron 6 of murine Tacc3DepositorUseAdenoviralTagsFLAG-Cas9PromoterU6 and CBhAvailable SinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pERM2-nhpSer
Plasmid#201922PurposeEnables translational incorporation of non-hydrolyzable phosphoserine into proteins at TAG codons in E coli. Do not use for phosphoserine incorporation.DepositorInsertsSepRS(2)
Sep-tRNA v2.0
SerB
EF-Sep
TagsNoneExpressionBacterialMutationE412P, E414F, T417K, P495M, I496W, F529S and H67R…PromoterGlnS (constitutive), OXB20 (constitutive), lpp (c…Available SinceJune 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEX6p1-Rbck1
Plasmid#63135PurposeExpression of human RBCK1/HOIL-1LDepositorInsertHOIL-1L (RBCK1 Synthetic, Human)
TagsGSTExpressionBacterialMutationSynthetic based on human protein sequencePromotertacAvailable SinceMarch 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1‐hsRNASEH2BCA
Plasmid#108692PurposeFor expression in E coli of N-terminally GST-tagged human RNASEH2B and untagged RNASEH2C and A, allowing affinity purification of the RNase H2 trimeric enzymeDepositorTagsGSTExpressionBacterialMutationShine Dalgarno sequence upstream of start codon a…PromotertacAvailable SinceApril 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
AFDN_PDZ_1
Plasmid#103938PurposeProtein expression and purification of TRITHORAX PDZ domainDepositorInsertAFDN (AFDN Human)
TagsGSTExpressionBacterialMutationcontains AA983-1110 of AFDNPromotertacAvailable SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
DLG1_PDZ_3
Plasmid#103917PurposeProtein expression and purification of DLG1 PDZ3 domainDepositorAvailable SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only