We narrowed to 1,690 results for: Tyr
-
Plasmid#127515PurposePlasmid encodes H. sapiens codon optimized Integrase 7.DepositorInsertIntegrase 7 coding sequence codon optimized for H. sapiens expression.
ExpressionMammalianMutationIn 2126 position an G mutated for an T changed th…Available SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET-30a(+)-Syk-tSH2-FX
Plasmid#111272Purposeexpress murine Syk tandem SH2 domains (Ser 8 to Gln 264), with interdomain A (Phe 119 to His 162) substituted by a flexible 20-amino-acid linker (GGS)3GS(GGS)3, in E.coli strain Rosetta 2 (DE3)DepositorInsertmurine Syk tandem SH2 domains (Ser 8 to Gln 264), with interdomain A (Phe 119 to His 162) substituted by a flexible 20aa linker (Syk Mouse)
ExpressionBacterialMutationinterdomain A (Phe 119 to His 162) substituted by…PromoterT7 promoterAvailable SinceJuly 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
Str-KDEL_CD63YA-SBP-EGFP
Plasmid#222327PurposeSynchronize the trafficking of CD63YA from the ER.DepositorInsertStreptavidin-KDEL and CD63-Y235A fused to SBP-EGFP (CD63 Human)
ExpressionMammalianMutationTyr235 to AlaPromoterCMVAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T-3-GST-Tev-Af1521(K35E/Y145R)-myc
Plasmid#196241PurposeN-terminal GST fusion of Af1521(K35E/Y145R) with a TEV protease site located between the GST tag and Af1521 and a myc tag on the C terminusDepositorInsertN-terminal GST fusion of Af1521(K35E/Y145R) with a TEV protease site between GST and Af1521 encoding a C-terminal myc tag
TagsGST tag and myc tagExpressionBacterialMutationamino acid 35 lysine is replaced with glutamic ac…Available SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLX304-BCL-XL-Y195F
Plasmid#203573PurposeExpresses V5-tagged BCL-XL with partial drug resistance to A-1331852 in mammalian cells.DepositorInsertBCL2L1 (BCL2L1 Human)
UseLentiviralTagsV5-taggedExpressionMammalianMutationChanged Tyrosine 195 to Phenylalanine for partial…PromoterCMVAvailable SinceFeb. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-FLT3-D835Y-V5/HIS
Plasmid#236007Purposeexpression of the D835Y kinase defective mutant variant of human FLT3 that is associated with Acute Myeloid Leukemia and Acute Lymphoblastic LeukemiaDepositorInserthuman FLT3-D835Y receptor tyrosine kinase, full length (FLT3 Human)
TagsV5/HisExpressionMammalianMutationD835Y substitutionPromoterCMVAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMal-Abl-PRM 5R
Plasmid#112088PurposeBacterial expression plasmid containing His and MBP tags for 5 PRM motif repeats of Human Abl.DepositorInsertPRM-5R (ABL1 Human)
TagsHis-6 and MBPExpressionBacterialMutationconstruct contains only the PRM motif of Abl1PromoterLacAvailable SinceFeb. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
MERTK gRNA (BRDN0001145505)
Plasmid#76444Purpose3rd generation lentiviral gRNA plasmid targeting human MERTKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDEST-ERBB3-v2
Plasmid#154894PurposeExpresses ERBB3 (a.k.a HER3) fused to Venus fragment 2 (v2) for use in bimolecular fluorescence complementation (BiFC) assaysDepositorAvailable SinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMal_Abl-PRM 3R
Plasmid#112086PurposeBacterial expression plasmid containing His and MBP tags for 3 PRM motif repeats of Human Abl.DepositorInsertAbl-PRM-3R (ABL1 Human)
TagsHis-6 and MBPExpressionBacterialMutationconstruct contains only the PRM motif of Abl1PromoterLacAvailable SinceFeb. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-FLT3-D835N-V5/HIS
Plasmid#236008Purposeexpression of the D835N kinase defective mutant variant of human FLT3 that is associated with Acute Myeloid LeukemiaDepositorInserthuman FLT3-D835N receptor tyrosine kinase, full length (FLT3 Human)
TagsV5/HisExpressionMammalianMutationD835N substitutionPromoterCMVAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMAL-Abl-PRM 4R
Plasmid#112087PurposeBacterial expression plasmid containing His and MBP tags for 4 PRM motif repeats of Human Abl.DepositorInsertAbl-PRM-4R (ABL1 Human)
TagsHis-6 and MBPExpressionBacterialMutationconstruct contains only the PRM motif of Abl1PromoterLacAvailable SinceFeb. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
FUW-ubiquitin-EphB2-SV40-GFP (B2G)
Plasmid#65442PurposeExpression of mouse EPHB2 and GFP in mammalian cellsDepositorInsertEPHB2 (Ephb2 Mouse)
UseLentiviralTagsSV40-EGFPExpressionMammalianMutationSee depositor comments below.PromoterUBQAvailable SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
AXL gRNA (BRDN0001146797)
Plasmid#76700Purpose3rd generation lentiviral gRNA plasmid targeting human AXLDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCDF-His-mTET1CD∆cat
Plasmid#81054Purposebacterial expression of catalytic dead catalytic domain of murine TET1DepositorInsertTET1 (Tet1 Mouse)
Tags6HISExpressionBacterialMutationcatalytic domain amino acid 1367-2057 with histid…PromoterT7Available SinceAug. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
AXL gRNA (BRDN0001147657)
Plasmid#76701Purpose3rd generation lentiviral gRNA plasmid targeting human AXLDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
AXL gRNA (BRDN0001146919)
Plasmid#76702Purpose3rd generation lentiviral gRNA plasmid targeting human AXLDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
EPHA3 gRNA (BRDN0001147883)
Plasmid#76743Purpose3rd generation lentiviral gRNA plasmid targeting human EPHA3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
EPHA3 gRNA (BRDN0001147140)
Plasmid#76745Purpose3rd generation lentiviral gRNA plasmid targeting human EPHA3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only