We narrowed to 3,556 results for: Braf;
-
Plasmid#31566DepositorInsertpCS4+-P2A
Available SinceJune 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
DS-TDcasN-
Plasmid#48660PurposeBacterial nuclease-null TD Cas9 expressionDepositorInsertsCas9, nuclease-null
TD tracrRNA
UseCRISPRMutationD to A, DH to AA, N to APromoterproC and tracrRNA promoterAvailable SinceApril 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
PM-SP!TB
Plasmid#48650PurposeBacterial SP crRNA expression: targets SP to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial SP crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSYC-102
Plasmid#74790PurposepCS4+-NLS-EGFP-T2A-mCherry-CAAXDepositorInsertNLS-EGFP-T2A-mCherry-CAAX
Available SinceJune 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
M28 Nac>GFP
Plasmid#17178DepositorInsertnacre promoter (mitfa Zebrafish)
TagsGFPAvailable SinceFeb. 1, 2008AvailabilityAcademic Institutions and Nonprofits only -
hsp70:GalT-RFP
Plasmid#105966Purposeheat shock inducible transgenesis, Galactsyl transferase (trans-golgi marker)DepositorInsertGalT
TagsmRFP1ExpressionBacterialAvailable SinceFeb. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
366 pTol2-CherryDest
Plasmid#73487Purposepromoterless Tol2 vector with mCherry tag upstream of and in frame with attR1/attR2 cassette and late SV40 polyadenylation signalDepositorInsertmCherry-attR1/attR2
MutationH30R (please see depositor comments below)Available SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pT7mitfagRNA
Plasmid#47931Purposein vitro transcription of mitfa gRNADepositorInsertmitfa gRNA (mitfa Zebrafish)
UseCRISPRAvailable SinceAug. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
M24 Nac>Nac
Plasmid#17174DepositorInsertnacre promoter driving nacre cDNA (mitfa Zebrafish)
Available SinceFeb. 1, 2008AvailabilityAcademic Institutions and Nonprofits only -
pSYC-104
Plasmid#74792PurposepCS4+-NLS-EGFP-F2A-mCherry-CAAXDepositorInsertNLS-EGFP-F2A-mCherry-CAAX
Available SinceJune 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
PM-TD!TB
Plasmid#48656PurposeBacterial TD crRNA expression: targets TD to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial TD crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGEM-T ZfHoxb10a
Plasmid#27530DepositorInsertHoxb10a (hoxb10a Zebrafish)
ExpressionBacterialAvailable SinceFeb. 16, 2011AvailabilityAcademic Institutions and Nonprofits only -
pSYC-103
Plasmid#74791PurposepCS4+-NLS-EGFP-E2A-mCherry-CAAXDepositorInsertNLS-EGFP-E2A-mCherry-CAAX
Available SinceJune 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
Tol2-ftyrp>TRAP
Plasmid#42299DepositorInsertEGFP-Rpl10a (rpl10a Zebrafish)
TagsEGFPPromoterTakifugu rubripes tyrosine related protein 1 (tyr…Available SinceMarch 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
huβB1cry:mAppleCAAX
Plasmid#122451PurposeHuman BB1 crystallin promoter driving mApple-CAAX in Tol2 destination vectorDepositorInsertHuman BB1 crystallin:mApple_CAAX
ExpressionBacterialPromoter300bp Human Beta B1 crystallin promoterAvailable SinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
IgM (exon 1-3)
Plasmid#11301DepositorInsertIgM (ighm Zebrafish)
ExpressionBacterialAvailable SinceFeb. 14, 2006AvailabilityAcademic Institutions and Nonprofits only -
XE245 Mouse Naked-2 CS2p+
Plasmid#16727DepositorAvailable SinceSept. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pZL1-ZF - myelin basic protein a (mbpa)
Plasmid#103007PurposePlasmid template for making in-situ hybridization probe for myelin basic protein a (mbpa) gene zf-fj330a07.y1.DepositorInsertmyelin basic protein (mbpa Zebrafish)
PromoterSp6Available SinceDec. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
SK-YFP-TD-B
Plasmid#48663PurposeBacterial TD repression YFP reporter: protospacer BDepositorInsertTD prototspacer B/PAM with reporter EYFP
UseCRISPRPromoterlambda pR promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-NM!TA
Plasmid#48651PurposeBacterial NM crRNA expression: targets NM to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial NM crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only