We narrowed to 4,446 results for: gca
-
Plasmid#129046Purposeinactivated control (targeted DNA demethylation_human_TSDR), expression of dCas9-hudTET1CD-T2A-mCherry sgRNA6 targeting human TSDRDepositorInsertdCas9-hudTET1CD, SgRNA6 (huTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A), catalytic domain huTET1 inact…PromoterCbH (for dCas9-hudTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003-sgCh2-4
Plasmid#125768Purposeconstitutive expression of a guide RNA targeting an intergenic region of human chromosome 2 (CRISPR cutting control)DepositorInsertsgCh2-4
UseCRISPRAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPHR-EYFP-hGCN5mut
Plasmid#103828PurposeSoluble BLInCR effector that is recruited to 'localizer' sites upon blue light illuminationDepositorExpressionMammalianMutationhGCN5: A566G (E189G), G585T (K195N), G726A (silen…PromoterCMVAvailable SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
GK2 gRNA (BRDN0001145991)
Plasmid#77910Purpose3rd generation lentiviral gRNA plasmid targeting human GK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CASK gRNA (BRDN0001149003)
Plasmid#77404Purpose3rd generation lentiviral gRNA plasmid targeting human CASKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GUCY2D gRNA (BRDN0001145533)
Plasmid#76034Purpose3rd generation lentiviral gRNA plasmid targeting human GUCY2DDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
HK3 gRNA (BRDN0001149028)
Plasmid#75781Purpose3rd generation lentiviral gRNA plasmid targeting human HK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
sgYAP-TAZ-3
Plasmid#229453Purposeknockout of YAP1 and WWTR1 (TAZ)DepositorUseCRISPR and LentiviralExpressionMammalianPromoterhU6;bU6;EFSAvailable SinceDec. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13C/sgKras/Cre
Plasmid#99856PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13C mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12S/sgKras/Cre
Plasmid#99853PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12S mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003-sgWRN-EIJ
Plasmid#125774Purposeconstitutive expression of a guide RNA targeting an exon-intron junction of human WRNDepositorInsertsgWRN-EIJ (WRN Human)
UseCRISPRAvailable SinceJune 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+) Laccase2 MCS-mFndc3b
Plasmid#126443PurposeExpresses mouse Fndc3b circular RNADepositorInsertFndc3b (Fndc3b Mouse)
ExpressionMammalianMutationcircFndc3b exons are separated by a miniature int…PromoterCMVAvailable SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12A/sgKras/Cre
Plasmid#99849PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12A mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
hNTa2-qgRNA-pYJA5
Plasmid#217780PurposeNon-targeting control 2 qgRNA-pYJA5 plasmid from the T.gonfio library; it can be used as a ready-to-go control and provides the three constant regions for the three-fragment PCRs for qgRNA cloningDepositorInsertQuadruple sgRNA-expression cassette for nontargeting control for gene activation and epigenetic silencing
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterhuman U6, mouse U6, human H1, human 7SKAvailable SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACYC-T7-SpCas9(BspMI/SapI/BsaI_cassettes)-T7-gRNA1 (BPK1807)
Plasmid#223065PurposeDual pT7 entry plasmid for SpCas9(6AA) library; bacterial expression plasmid with type IIS RE cassettes around D1135/S1136, G1218/E1219, R1335/T1337 (precursor to MMW94). Expresses a gRNA.DepositorInsertentry vector for human codon opt. bacterial expr. plasmid for SpCas9(6AA_NNS) library, with gRNA targeting EGFP site 1
UseCRISPRTagsNLS(SV40)-3xFLAGExpressionBacterialMutationThree regions of SpCas9 encode type IIS restricti…PromoterDual T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+) Laccase2 MCS-mFndc3b Mutant miRNAs
Plasmid#126444PurposeExpresses a mutated version of mouse Fndc3b circular RNA with the miR-93-3p, miR-258-5p, and miR-412-3p target sites all mutatedDepositorInsertFndc3b (Fndc3b Mouse)
ExpressionMammalianMutationcircFndc3b exons are separated by a miniature int…PromoterCMVAvailable SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(ARID1A(44))-hU6gRNA5(ARID1B(21))-PGKpuroBFP-W
Plasmid#200507PurposeLentiviral vector expressing gRNA targeting human ARID1A and ARID1BDepositorAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(ARID1A(44))-hU6gRNA5(ARID1B(23))-PGKpuroBFP-W
Plasmid#200508PurposeLentiviral vector expressing gRNA targeting human ARID1A and ARID1BDepositorAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4-eIF3B MBE2 mutant
Plasmid#133309PurposeExpression of luciferase driven by eIF3B promoter region mutated at the E-box binding motif 2DepositorInserteIF3B promoter MBE2 mutant (EIF3B Human)
UseLuciferaseExpressionMammalianMutationgccacatgcacc changed to gcAaAaAAcaccPromotereIF3BAvailable SinceOct. 28, 2019AvailabilityAcademic Institutions and Nonprofits only