169,348 results
-
Plasmid#75023PurposeCan be used to drive expression in zebrafish microglia.DepositorInsertmacrophage expressed 1, tandem duplicate 1 (mpeg1.1 Zebrafish)
Use5' entry vector for multisite gateway three …Promotermpeg1.1Available SinceOct. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SpyCatcher002-oPent
Plasmid#124664PurposeExpresses SpyCatcher002-oPent for pentamerization of SpyTag-proteins via pentameric coiled-coilDepositorInsertSpyCatcher002-oPent
TagsC-tag, His6, and TEV cleavage siteExpressionBacterialPromoterT7Available SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSH62-EBD
Plasmid#49455Purposeyeast expression of Cre recombinase fused to the estrogen binding domain (EBD), which confers estradiol-dependent control to Cre recombinaseDepositorInsertCre-EBD fusion
UseCre/LoxExpressionYeastPromoterGal1 promoterAvailable SinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFRTpsiCHECK
Plasmid#154454PurposeExpression of renilla luciferase and firefly luciferaseDepositorInsertRenilla luciferase, firefly luciferase
Available SinceAug. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
CXCR7-DuET
Plasmid#213224PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
Opie2-PuroR
Plasmid#131613PurposeExpresses PuroR and dsRed.DepositorInsertsPuroR
dsRed
ExpressionInsectPromoterOpie2 and hr5Ie1Available SinceMay 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC19-TgKI-MCS-mLanYFP-polyA
Plasmid#174021PurposeThis plasmid is used for generating C-terminal knock-in plasmid and/or PCR donors in zebrafish.DepositorInsertmLanYFP
UseZebrafish knock-in taggingAvailable SinceNov. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET His6 GFP TEV LIC cloning vector (1GFP)
Plasmid#29663DepositorHas ServiceCloning Grade DNATypeEmpty backboneTags6xHis, GFP, and TEV cleavage siteExpressionBacterialPromoterT7-lacO (lactose/IPTG inducible)Available SinceJune 7, 2011AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS106a
Plasmid#87382PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMK289 (mAID-mClover-NeoR)
Plasmid#72827PurposeC-terminal tagging with mAID-mClover using CRISPR/Cas9DepositorInsertmAID-mClover-Neo
UseCRISPRTagsmAID-mCloverExpressionMammalianAvailable SinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only