We narrowed to 5,965 results for: crispr cas9 expression plasmids
-
Plasmid#65593Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 geneDepositorInsertsgRNA for APa13
UseCRISPRTagsExpressionWormMutationPromoterU6Available sinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP56-5
Plasmid#65591Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 geneDepositorInsertsgRNA for APa13
UseCRISPRTagsExpressionWormMutationPromoterU6Available sinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP56-8
Plasmid#65596Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 geneDepositorInsertsgRNA for APa13
UseCRISPRTagsExpressionWormMutationPromoterU6Available sinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP56-7
Plasmid#65594Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 geneDepositorInsertsgRNA for APa13
UseCRISPRTagsExpressionWormMutationPromoterU6Available sinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP54-3
Plasmid#65597Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 geneDepositorInsertsgRNA for APs12
UseCRISPRTagsExpressionWormMutationPromoterU6Available sinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-dSa-VP64-p65(100-261)-RTA(125-190)
Plasmid#99679PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domainsDepositorArticleInsertdCas9
UseAAVTagsVP64-p65(101-261)-RTA(125-190)ExpressionMutationdead Cas9PromoterAvailable sinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
BPK1520
Plasmid#65777PurposeHuman expression plasmid for SpCas9 sgRNA (need to clone in spacer into BsmBI sites): U6-BsmBIcassette-Sp-sgRNADepositorInsertSpCas9 gRNA backbone, without spacer sequence
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDIV515
Plasmid#177703PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
tRNA-sgRNA-tRNA
UseCRISPRTagsSV40ExpressionBacterial and YeastMutationPromoterRNR2p (Debaryomyces hansenii ), TDH3p (Candida lu…Available sinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV537
Plasmid#177704PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting KU70 homolog in D. hanseniiDepositorInsertsCas9
Nat
tRNA-sgRNA-tRNA
UseCRISPRTagsSV40ExpressionBacterial and YeastMutationPromoterRNR2p (Debaryomyces hansenii ), TDH3p (Candida lu…Available sinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastMutationPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available sinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV495
Plasmid#177702PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAaGCAGATTAAtGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastMutationPromoterRNR2p (Debaryomyces hansenii ), SRC1p (Debaryomyc…Available sinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSc2
Plasmid#80437PurposeExpresses eGFP along with an U6 promoter driven gRNA which cleaves the plasmid in-cellDepositorInsertssp Cas9 gRNA
eGFP
UseCRISPRTagsExpressionMammalianMutationPromoterCMV and U6Available sinceSept. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pH1v1
Plasmid#60244PurposegRNA expression by the H1 promoterDepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterH1 promoterAvailable sinceOct. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pUC gRNA Shuttle
Plasmid#47024PurposeEncodes a template from which gRNAs can be made via InFusion cloning. The Medicago truncatula U6.6 promoter drives the gRNA. For use in plants.DepositorInsertgRNA Shuttle
UseCRISPR; Cas9TagsExpressionPlantMutationG to T cloning mutation at position 323PromoterMedicago truncatula U6.6Available sinceSept. 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBlu/gRNA
Plasmid#59188PurposeServes as a shuttle vector for target oligo before insertion into Cas9 destination vectorDepositorInsertGuide RNA Cassette
UseCRISPRTagsExpressionPlantMutationPromoterU6 (Arabidopis)Available sinceFeb. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUDP003
Plasmid#101164PurposeE. coli/S. cerevisiae amdS shuttle vector allowing cloning of ribozyme flanked g-RNA for Cas9 editing (HH-gRNA-HDV)DepositorTypeEmpty backboneUseCRISPRTagsExpressionYeastMutationPromoterScTDH3Available sinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUDP004
Plasmid#101165PurposeE. coli/S. cerevisiae shuttle vector carrying amd S marker and Spcas9D147Y P411T allowing cloning of ribozyme flanked g-RNA for Cas9 editing (HH-gRNA-HDV)DepositorTypeEmpty backboneUseCRISPRTagsExpressionYeastMutationPromoterScTDH3Available sinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEG302 22aa SunTag NtDRMcd (no NLS) g4+g10+g18 (FWA)
Plasmid#117168PurposeCRISPR Cas9 SunTag system to target NtDRMcd (without an NLS) to the FWA locus with three guide RNAsDepositorInsertg18_U6_g10_U6_g4_U6_NOS_NLS_GB1_noNLS_linker_DRMcd_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoterAvailable sinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMpGE_En03
Plasmid#71535PurposeUsed to construct a gRNA expression cassette for CRISPR/Cas9 genome editing in Marchantia polymorphaDepositorTypeEmpty backboneUseCRISPRTagsExpressionMutationPromoterAvailable sinceMarch 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pZBTB12.1.0-gDNA
Plasmid#113769PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZBTB12DepositorInsertZBTB12 (ZBTB12 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only