We narrowed to 3,217 results for: Streptococcus
-
Plasmid#86610PurposeExpresses the ATP1A1 G2 sgRNA in combination with FLAGless eSpCas9(1.1) to target ATP1A1 exon 4. Px330-like plasmidDepositorInsertATP1A1 G2 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via nhej using ouabainExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable sinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-FKBP12_F36V-KRAB-SpdCas9-tagBFP-PGK-Blasticidin
Plasmid#187957PurposeFKBP12 (F36V mutant) degron-tagged KRAB-dCas9 fused with tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertFKBP12_F36V-KRAB-SpdCas9-tagBFP
UseCRISPR and Synthetic BiologyTagsGGSExpressionMammalianAvailable sinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDG335
Plasmid#100899PurposeSpCas9n (D10A Nickase mutant) with a cloning backbone for 2 custom gRNAs which can be cloned in via a one-step reaction. For generation of DSBs with no off-target cuts.DepositorInsertshumanized CRISPR associated protein 9 Nickase
U6-gRNA scaffold 1
U6-gRNA scaffold 2
UseCRISPR and Mouse TargetingTagsHAExpressionMammalianMutationD10A mutant converts to NickasePromoterCBh and U6Available sinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_4
Plasmid#155062PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and three intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and three intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
px459-sgPNPLA3
Plasmid#255036PurposeUsed to generate PLNPLA3 knockout; targets Exon 3DepositorInsertCRISPR Cas9 guide for PNPLA3 exon 3
UseCRISPRExpressionMammalianPromoterU6Available sinceJune 18, 2026AvailabilityAcademic Institutions and Nonprofits only -
SP_0843
Plasmid#255516PurposeDERA enzyme production under control of T7 promoter and inducible lac operatorDepositorInsert2-deoxyribose-5-phosphate aldolase (DERA) from Streptococcus pneumoniae serotype 4
Tags6xHis tag-TEV protease recognition site (ENLYFQ/G…ExpressionBacterialMutationWTPromoterT7Available sinceMay 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
SpG_ATH51-IP
Plasmid#242074PurposeExpresses Cas9-SpG_ATH51 in mammalian cellsDepositorInsertSpG_ATH51
UseCRISPRExpressionMammalianMutationectopic insertion of 7 amino acids of PID turn-he…Available sinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Merry Target 3- eCMV- SaSp-3XFLAG-SV40NLS-ITR2
Plasmid#210743PurposeCoding for SaSp Cas9 alongside Merry sgRNA targeting GFP Target 3DepositorPublicationInsertsSaSp Cas9
Merry sgRNA GFP Target 3
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationN-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable sinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pUC57-ITR2-H1-GFP sgRNA Merry Target 4- eCMV- SaSp-3XFLAG-SV40NLS-ITR2
Plasmid#210744PurposeCoding for SaSp Cas9 alongside Merry sgRNA targeting GFP Target 4DepositorPublicationInsertsSaSp Cas9
Merry sgRNA GFP Target 4
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationN-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable sinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pUC57-ITR2-H1-GFP sgRNA Gollum Target 3- eCMV- SaSp-3XFLAG-SV40NLS-ITR2
Plasmid#210747PurposeCoding for SaSp Cas9 alongside Gollum sgRNA targeting GFP Target 3DepositorPublicationInsertsSaSp Cas9
Gollum sgRNA GFP Target 3
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationN-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable sinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pUC57-ITR2-H1-GFP sgRNA Gollum Target 4- eCMV- SaSp-3XFLAG-SV40NLS-ITR2
Plasmid#210748PurposeCoding for SaSp Cas9 alongside Gollum sgRNA targeting GFP Target 4DepositorPublicationInsertsSaSp Cas9
Gollum sgRNA GFP Target 4
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationN-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable sinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pUC57-ITR2-H1-GFP sgRNA Gollum Target 2- eCMV- SaSp-3XFLAG-SV40NLS-ITR2
Plasmid#210746PurposeCoding for SaSp Cas9 alongside Gollum sgRNA targeting GFP Target 2DepositorPublicationInsertsSaSp Cas9
Gollum sgRNA GFP Target 2
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationN-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable sinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pUC57-ITR2-H1-GFP sgRNA Merry Target 1- eCMV- SaSp-3XFLAG-SV40NLS-ITR2
Plasmid#210741PurposeCoding for SaSp Cas9 alongside Merry sgRNA targeting GFP Target 1DepositorPublicationInsertsSaSp Cas9
Merry sgRNA GFP Target 1
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationN-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable sinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pUC57-ITR2-H1-GFP sgRNA Gollum Target 1- eCMV- SaSp-3XFLAG-SV40NLS-ITR2
Plasmid#210745PurposeCoding for SaSp Cas9 alongside Gollum sgRNA targeting GFP Target 1DepositorPublicationInsertsSaSp Cas9
Gollum sgRNA GFP Target 1
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationN-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable sinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pUC57-ITR2-H1-GFP sgRNA Merry Target 2- eCMV- SaSp-3XFLAG-SV40NLS-ITR2
Plasmid#210742PurposeCoding for SaSp Cas9 alongside Merry sgRNA targeting GFP Target 2DepositorPublicationInsertsSaSp Cas9
Merry sgRNA GFP Target 2
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationN-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable sinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
P2061
Plasmid#186299PurposeExpresses LexA-HBD-B112 under the control of pAct1 and Cas9 under the control of LexA-HBD-B112+Beta-estradiol inducible promoterDepositorInsertsLexA-HBD-B112
Cas9
UseCRISPR and Synthetic BiologyExpressionBacterial and YeastPromoter2xLexop-minimalCyc1 and PACT1Available sinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgTS40
Plasmid#169630PurposepX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.DepositorInsertU6-driven gRNA expression and PCAG-driven SpCas9 expression
ExpressionMammalianPromoterU6 / PCAGAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVH333-1-Tier1-PhCMV-dCas9-3xNLS-VP64
Plasmid#169597PurposeTier-1 vector encoding PhCMV-driven dCas9-3xNLS-VP64 expression (PhCMV-dCas9-3xNLS-VP64-pA).DepositorInsertdead S.pyogenes Cas9 - VP64 fusion
ExpressionMammalianPromoterPhCMVAvailable sinceJuly 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGG438
Plasmid#165486PurposeVector for expression of the SpCas9 VRKG variant in human cells: CMV-T7-humanVRKG(SpCas9, D1135V/S1136R/D1332K/R1333G)-1xNLS(SV40)-3xFLAGDepositorInsertMammalian codon-optimized Streptococcus pyogenes Cas9 VRKG(D1135V/S1136R/D1332K/R1333G)-1xNLS(SV40)-3xFlag
UseCRISPRTags3x FLAG and SV40 NLSExpressionMammalianMutationD1135V, S1136R, D1332K, and R1333G mutations in S…PromoterCMV and T7Available sinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC19-Q2RX87
Plasmid#103122PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertQ2RX87(Cas9 coding gene from Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9))
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only