We narrowed to 27,439 results for: cat
-
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGS_N_3xFLAG
Plasmid#101654PurposeExpression of type I signal-peptide containing proteins with N-terminal 3xFLAG-tag in insect cellsDepositorInsertLRP6 Signal peptide, KpnI linker, 3xFLAG tag
Tags3xFLAG tagExpressionInsectAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
1099-N-cadherin-AAA-YFP
Plasmid#32237DepositorInsertN-cadherin (Cdh2 Mouse)
TagsEYFPExpressionMammalianMutationGlu–Glu–Asp (aa 780–782) ---> Ala–Ala–AlaPromoterCMVAvailable SinceOct. 26, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Tag/M1 S245X
Plasmid#92366Purposeexpression of M1 S245X spastin in mammalian cellsDepositorInsertspastin (SPAST Human)
ExpressionMammalianMutation1-194 bp of 5'UTR deleted, S245XPromoterCMVAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSilencer2.1-U6-3JB8F+12
Plasmid#190854PurposeFor mammalian expression of 3JB8F+12, a dual-specificity aptamer that binds OGT and β-catenin. Expression is driven by a U6 promoter. This dual-specificity aptamer adopts a folded linker.DepositorInsert3JB8F_T1+12bp (A Dual-Specificity aptamer targeting OGT and β-catenin)
UseAffinity Reagent/ Antibody and Synthetic BiologyExpressionMammalianPromoterU6Available SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
MS2-adRNA (5'UAG)
Plasmid#170126PurposeLentiviral vector carrying 2 copies of the MS2 adRNA targeting a UAG at the 5' end of the ADAR2 deaminase domain in plasmids #170124 and 170125DepositorInsertMS2-ADAR2(5'UAG)-MS2
UseLentiviralExpressionMammalianPromoterHuman U6 and mouse U6Available SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1V5-His Snk/Plk2 D223N
Plasmid#22218DepositorInsertSnk/Plk2 (PLK2 Human)
ExpressionMammalianMutationsingle amino acid substitution mutant, aspartic a…Available SinceAug. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_PKA-CαN (K29,30A)-mVenus
Plasmid#168485PurposeMammalian expression of the K29,30A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus.DepositorInsertthe K29,30A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus
ExpressionMammalianAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Tag/M87 S245X
Plasmid#92368Purposeexpression of M87 S245X spastin in mammalian cellsDepositorAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSilencer2.1-U6-NL8F100
Plasmid#190852PurposeFor mammalian expression of NL8F100, a dual-specificity aptamer that binds OGT and β-catenin. Expression is driven by a U6 promoter. This dual-specificity aptamer adopts a flexible linker.DepositorInsertNL8F100 (A Dual-Specificity aptamer targeting OGT and β-catenin)
UseAffinity Reagent/ Antibody and Synthetic BiologyExpressionMammalianPromoterU6Available SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTorPE-Y-GECO1
Plasmid#55765PurposeEncoded a yellow fluorescent calcium ion indicator with inverted fluorescence response for expression in bacterial cellsDepositorInsertY-GECO1.0
UseLab constructedTags6x His tagExpressionBacterialPromoterpBADAvailable SinceJuly 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1‐Afu‐rnhBΔPIP
Plasmid#108696PurposeFor expression in E. coli, and affinity purification of N-terminally GST-tagged Archaeoglobus fulgidus RNase HII with C-terminal PIP box deletionDepositorInsertrnhB
TagsGSTExpressionBacterialMutationC-terminal truncation (7aa) removing PIP boxPromotertacAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
mTFP1-Tubulin-6
Plasmid#55512PurposeLocalization: Microtubules, Excitation: 462, Emission: 492DepositorAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_PKA-CαN(E12,14K)-mPAGFP
Plasmid#168495PurposeMammalian expression of the E12,14K mutant of the N-terminal 47 residues of mouse PKA Catalytic subunit α C-terminally tagged by monomeric paGFP.DepositorInsertE12,14K mutant of the N-terminal 47 residues of mouse PKA Catalytic subunit α C-terminally tagged by monomeric paGFP
ExpressionMammalianAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
MS2-adRNA (3'UAG)
Plasmid#170128PurposeLentiviral vector carrying 2 copies of the MS2 adRNA targeting a UAG at the 3' end of the ADAR2 deaminase domain in plasmids #170124 and 170125DepositorInsertMS2-ADAR2(3'UAG)-MS2
UseLentiviralExpressionMammalianPromoterHuman U6 and mouse U6Available SinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
LjUBQ:MtGLV6:T35s
Plasmid#164741PurposeOverexpression of Peptide coding gene (Binary vector)DepositorInsertMedtr3g095180.1
TagsTerminator 35SExpressionPlantPromoterLotus japonicus UbiquitinAvailable SinceDec. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
LjUBQ:MtGLV2:T35s
Plasmid#164740PurposeOverexpression of Peptide coding gene (Binary vector)DepositorInsertMedtr5g012400.1
TagsTerminator 35SExpressionPlantPromoterLotus japonicus UbiquitinAvailable SinceDec. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
px330-UFSP2 sgRNA1
Plasmid#134638Purposecontains sgRNA targeting human UFSP2 for gene knockoutDepositorInsertUFSP2 sgRNA1 (UFSP2 Human)
ExpressionMammalianAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
mTFP1-Rab4a-7
Plasmid#55507PurposeLocalization: Ras GTPase, Excitation: 462, Emission: 492DepositorAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER20-Flag-NLS-hSPDEF delta1
Plasmid#100874PurposeLentiviral expression of human SPDEF truncationDepositorInsertSPDEF (SPDEF Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationtruncated protein 1-248aaPromoterTRE2Available SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only