We narrowed to 15,272 results for: grn
-
Plasmid#26629DepositorAvailable sinceOct. 22, 2010AvailabilityAcademic Institutions and Nonprofits only
-
pMZ283
Plasmid#52224PurposeExpression of sgRNA precursor with CspCI placeholder for target cloning (see comments).DepositorInsertrrk1-sgRNA
UseCRISPRExpressionYeastPromoterrrk1Available sinceOct. 29, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-U6-pegSERPINA1-U6-Nicking-PE2-N
Plasmid#164907PurposeExpress a pegRNA targeting SERPINA1, and a nicking sgRNA and the N-terminal split-intein fragment of PE2DepositorInsertpegSERPINA1, Nicking sgRNA, PE2-N
UseAAVAvailable sinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRyl_XPR2
Plasmid#84609PurposeIntroduces DSB at XPR2 locus in Y. lipolyticaDepositorPublicationInsertCas9
UseCRISPR and Synthetic BiologyExpressionYeastPromoterUAS1B8-TEF(136)Available sinceDec. 22, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLenti X2 Blast/shp16 (w112-1)
Plasmid#22261DepositorInsertsh cyclin-dependent kinase inhibitor 2A
UseLentiviral and RNAiAvailable sinceDec. 15, 2009AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pXJ385-pAAV-PB3’IR-U6-gRNA-EF1a-mScarlet-KASH-PB5’IR
Plasmid#224435PurposeAAV piggybac transposon vector, with mScarlet-KASH reporter and gRNA cloning site. Compatible with 10X 5' gRNA capture technology.DepositorInsertsmScarlet-KASH
U6-gRNA
UseAAV and CRISPRExpressionMammalianAvailable sinceAug. 20, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AAV2 for Split-PE, gRNAs + MMLV-RT(dRH)-P2A-eGFP (PKC1002)
Plasmid#190112PurposeAAV2 for expression of pegRNA and ngRNA (HEKs3, CTT insertion) + MMLV-RT(dRH)-P2A-eGFPDepositorInsertsMMLV-RT(dRH)
U6-pegRNA(HEKs3, CTT ins)-H1-ngRNA(HEK s3)
UseAAVTagsbpNLS and bpNLS-P2A-eGFPMutationmutations from RT in PE2 and truncation of RNAse …PromoterEFS and U6, H1Available sinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
1313_pAAV-U6-SA-BbsI-MluI-gRNA-HLP-SACas9-HA-OLLAS-spA
Plasmid#109314PurposePlasmid for liver-specific expression of AAV SaCas9 with a BbsI cloning site for a gRNADepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianAvailable sinceJan. 31, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
MDH1-PGK-GFP-miR9
Plasmid#25036DepositorPublicationAvailable sinceJune 7, 2010AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLV.PARP1#4
Plasmid#14547DepositorPublicationAvailable sinceMarch 27, 2007AvailabilityAcademic Institutions and Nonprofits only -
pXPR_502_sgCD4
Plasmid#158704PurposeCD4 CRISPRa controlDepositorInsertCD4 (CD4 Human)
UseLentiviralAvailable sinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-G3BP1-3'UTR
Plasmid#136038PurposeG3BP1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCTGTAAGAAATACAGGATT)DepositorAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-shRNA_Tet3
Plasmid#85740PurposeshRNA against mouse Tet3DepositorAvailable sinceApril 11, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pKLV2.2-mU6epegRNA(SapI)-hU6epegRNA(BbsI)-PGKpuroBFP-W
Plasmid#260204PurposeEmpty vector for dual pegRNA expression that can be cloned in individually using either SalI or BbsIDepositorTypeEmpty backboneUseCRISPR, Lentiviral, and Synthetic BiologyTagsBFPAvailable sinceSept. 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-del_exon5-gRNA1a_(CJT90)
Plasmid#226989PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-del_exon5 cell line via nuclease mediate excision, gRNA 1a must be used with gRNA 2a or 2bDepositorInsertSpCas9 gRNA 1a to create OPA1-del_exon5
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-del_exon5-gRNA2a_(CJT91)
Plasmid#226991PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-del_exon5 cell line via nuclease mediate excision, gRNA 2a must be used with gRNA 1a or 1bDepositorInsertSpCas9 gRNA 2a to create OPA1-del_exon5
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-createR194G-A6-gRNA_(CJT88)
Plasmid#226987PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-R194G cell line via adenine base editing (target base in position A6)DepositorInsertSpCas9 gRNA A6 to create OPA1-R194G
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-createR194G-A7-gRNA_(CJT89)
Plasmid#226986PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-R194G cell line via adenine base editing (target base in position A7)DepositorInsertSpCas9 gRNA A7 to create OPA1-R194G
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-del_exon5-gRNA2b_(CJT93)
Plasmid#226992PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-del_exon5 cell line via nuclease mediate excision, gRNA 2b must be used with gRNA 1a or 1bDepositorInsertSpCas9 gRNA 2b to create OPA1-del_exon5
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-del_exon5-gRNA1b_(CJT92)
Plasmid#226990PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-del_exon5 cell line via nuclease mediate excision, gRNA 1b must be used with gRNA 2a or 2bDepositorInsertSpCas9 gRNA 1b to create OPA1-del_exon5
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only