168,341 results
-
Plasmid#144924PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHoss1
Plasmid#63158PurposeSuicide plasmid for efficient gene mutation in Gram-positive bacteriaDepositorInsertanti-secY-Pxyl/tetO-tetR
UseSuicide plasmid for gram-positive bacteriaAvailable SinceSept. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHyo245
Plasmid#173147PurposeExpresses pheS_A294G by dual T7 promoter in e.coliDepositorInsertpheS_A294G
ExpressionBacterialAvailable SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
DD-DamV133A-LMNB1-IRES2-mCherry
Plasmid#159599PurposeShield-1 inducible transient mammalian expression of Dam-LMNB1 for DamID, containing the V133A mutant of Dam.DepositorInsertDD-DamV133A-LMNB1-IRES2-mCherry
ExpressionMammalianMutationDam V133A mutationPromoterCMVAvailable SinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCIneoEGFP
Plasmid#46949PurposeGFP in Promega pCIneo (uses CMV promoter). Superior to pfwB for some purposesDepositorInsertGFP
ExpressionMammalianPromoterCMVAvailable SinceAug. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_PLK1_Pkinase
Plasmid#109933PurposeProtein expression and purification of PLK1_PkinaseDepositorInsertPLK1_Pkinase
ExpressionBacterialAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFP-2xPH-TAPP1 WT
Plasmid#161990PurposeExpresses two tandem repeats of Tapp1 PH domain that binds to PI(3,4)P2. Fused to eGFPDepositorAvailable SinceApril 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
DT12A
Plasmid#80416PurposeExpresses 12 CUG repeats in the context of human DMPK genomic segment containing exons 11-15 with repeats inserted at site in exon 15 that contains the repeatsDepositorInserthuman DMPK exons 11-15 with 12 CTG repeats (DMPK Human)
ExpressionMammalianAvailable SinceSept. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-EF1a-KRAB-dCas9-P2A-BlastR
Plasmid#118154PurposeCatalytically inactive Cas9 from S. pyogenes with P2A-BlastR under the EF1a core promoter, and cloning backbone for sgRNA. Contains BsmBI sites for insertion of spacer sequences.DepositorInsertKRAB-dCas9-P2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianMutationSee depositor comments belowPromoterEF1a core and U6Available SinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only