We narrowed to 14,223 results for: Cas9
-
Plasmid#64322PurposeVector for repair of the traffic light reporter (TLR), providing the venus coding regionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertVenus
UseArtificial targeting vectorMutationsee publication for detailsPromoternoneAvailable sinceMay 19, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCN-EF2132tet
Plasmid#107191PurposeExpresses EF2132 recombinase for performing recombineering in S. aureusDepositorInsertsEF2132
tetR
ExpressionBacterialPromoterp23Available sinceFeb. 26, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSA127 A2UCOE-Cas9-BFP
Plasmid#249151PurposeOverexpression of SpCas9-BFP and blasticidin resistance gene. Contains minimal A2UCOE and Cp36 recombination site.DepositorInsertA2UCOE-Cas9-TagBFP
UseCRISPR; Cp36 donor dnaExpressionMammalianPromoterEF1aAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS911b
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1309a
Plasmid#87399PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJA58
Plasmid#59933PurposegRNA for cleavage at dpy-10(cn64) locus in C elegansDepositorInsertdpy-10(cn64) gRNA
UseCRISPRPromoterU6Available sinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
U6-CjCas9-MS2gRNA-Backbone
Plasmid#210711PurposeThis plasmid express MS2 loop containing Cj Cas9 gRNADepositorInsertMS2 loop containing Cj Cas9 gRNA
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459_gRNA pAS dual_hspCas9
Plasmid#193312PurposeCas9 from S. pyogenes and U6-pAS dual sgRNA (V2.0)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCas9 from S. pyogenes and U6-pAS dual sgRNA (V2.0)
UseCRISPRExpressionMammalianMutationnot applicableAvailable sinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pG3K-U6EC1
Plasmid#134757PurposepGreen3 CRISPR/Cas9DepositorInsertCRISPR/Cas9
UseCRISPRPromotergRNA-U6, zCas9-EC1Available sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pG3B-U6EC1
Plasmid#134756PurposepGreen3 CRISPR/Cas9DepositorInsertCRISPR/Cas9
UseCRISPRPromotergRNA-U6, zCas9-EC1Available sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pG3H-U3Ub
Plasmid#134749PurposepGreen3 CRISPR/Cas9DepositorInsertCRISPR/Cas9
UseCRISPRPromotergRNA- OsU3, zCas9-Ubi1Available sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pG3GB411
Plasmid#134748PurposepGreen3 CRISPR/Cas9DepositorInsertCRISPR/Cas9
UseCRISPRPromotergRNA- OsU3, zCas9-Ubi1Available sinceDec. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQ131A
Plasmid#69273PurposeGolden Gate entry vector; 1st gRNA under AtU6 promoterDepositorTypeEmpty backboneUseCRISPRAvailable sinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
YE1-BE4max-NG
Plasmid#138159PurposeC-to-T base editorDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertrAPOBEC1(YE1)-nSpCas9(NG)-UGI-UGI
TagsNLSExpressionMammalianMutationWithin rAPOBEC1 W90Y + R126E; within Cas9 D10A + …PromoterCMVAvailable sinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
reporter-gT1
Plasmid#47320PurposeTF reporter for gRNA-AAVS1_T1 (RNA-guided dTomato expression)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertminCMV-dTomato_pA
UseCRISPRAvailable sinceAug. 16, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PU6::klp-12_sgRNA
Plasmid#46170Purposeklp-12 targeting sgRNADepositorInsertklp-12 targeting sgRNA (klp-12 Synthetic)
UseCRISPRExpressionWormPromoterC. elegans U6 snRNA pol III promoterAvailable sinceJuly 1, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
NM9-SpCas9-NLS3
Plasmid#128177PurposeExpresses R. toruloides codon-optimized SpCas9 under PGK1 promoterDepositorInsertSpCas9-NLS3
UseCRISPRExpressionYeastPromoterpPGK1Available sinceApril 1, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
BFP dest clone
Plasmid#71825PurposeLentiviral introduction of BFP reporter (Point mutation H66 in mEGFP results in BFP expression)DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable sinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pB-nCas9-PBE
Plasmid#98160PurposeExpresses CRISPR base editor in maizeDepositorInsertNLS-APOBEC1-XTEN-nCas9-UGI-NLS
UseMaizeExpressionPlantPromoterUbiAvailable sinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only