We narrowed to 3,102 results for: sv40
-
Plasmid#233938PurposeMammalian expression of Chimeric Higher-Order Assemblies for Receptor Mediated Signaling (CHARMS) variant: CHARMS-TIR with 5 TRAF6 binding motifsDepositorInsertCHARMS-TIR-5xT6BMs
UseLentiviralTagsmEGFPExpressionMammalianPromoterSV40Available SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pIVT-evoBxb1
Plasmid#232747PurposeIVT template for making modRNA encoding evoBxb1DepositorInsertBxb1
UseIn vitro transcriptionTagsHA and SV40 NLSMutationV74AAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Sga-Cas9
Plasmid#227005PurposeMammalian expression of Nuclease active S. gallolyticus Cas9DepositorInsertCas9
UseCRISPRTags3xFLAG, SV40 NLSExpressionMammalianPromoterCMVAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Sin-Cas9
Plasmid#227006PurposeMammalian expression of Nuclease active S. iniae Cas9DepositorInsertCas9
UseCRISPRTags3xFLAG, SV40 NLSExpressionMammalianPromoterCMVAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Spa-Cas9
Plasmid#227007PurposeMammalian expression of Nuclease active S. parasanguinis Cas9DepositorInsertCas9
UseCRISPRTags3xFLAG, SV40 NLSExpressionMammalianPromoterCMVAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Sub-Cas9
Plasmid#227008PurposeMammalian expression of Nuclease active S. uberis Cas9DepositorInsertCas9
UseCRISPRTags3xFLAG, SV40 NLSExpressionMammalianPromoterCMVAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
3xMS-TR-100-PURO HRD
Plasmid#207582Purposehomologous recombination donor for the insertion of the 3xMS2-tag at the endogenous locusDepositorInsert3xMS2-TR and 100 bp of downstream sequence followed by a PuroR and flanked by endogenous TR sequences
Tags3xMS2ExpressionMammalianPromoterSV40Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
GB1531
Plasmid#215242PurposeTU for constitutive expression of Streptomyces phage phiC31 integrase. Catalyzes site-specific recombination between phiC31 attB and attP sites. Contains SV40 NLS. N. benthamiana codon optimized.DepositorInsertPNos:PhiC31:TNos
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJune 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCL390
Plasmid#219500PurposeIntegrating inducible cassette (Cas9-P2A-Csy4 and Eco1 RT) for yeast overexpressionDepositorInsertIntegrating inducible cassette: Cas9-P2A-Csy4 and Eco1 RT
TagsSV40-NLSExpressionYeastPromoterGAL1-GAL10Available SinceMay 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
psicheck2-PHLPP2
Plasmid#203605PurposeReporter plasmid carrying PHLPP2 3'UTRDepositorInsertPH domain and leucine rich repeat protein phosphatase 2 (PHLPP2 Human)
UseLuciferaseExpressionMammalianPromoterSV40Available SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
psicheck2-27bT
Plasmid#203600PurposeReporter plasmid carrying miR-27b target sequenceDepositorInsertcomplementary sequence to miR27b-3p (MIR27B Human)
UseLuciferaseExpressionMammalianPromoterSV40Available SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
H_NLS 27kDa
Plasmid#201363PurposeNucleocytoplasmic transport probeDepositorInsert(NLS)SV40-EGFP
ExpressionMammalianAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
lenti-Cas9-sgHPRT1
Plasmid#196713PurposeCRISPR-KO. WT-SpCas9 and sgRNA targeting HPRT1. Editing-competent cells can be selected with 6-TGDepositorInsertCas9-T2A-BSD-U6-sgHPRT1
UseCRISPR and LentiviralTagsNucleoplasmin NLS and SV40 NLSPromoterEF1a/hU6Available SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pcoCASphi_E9t_MCS_version1
Plasmid#197937PurposeT-DNA binary vector to express pcoCasphi driven by UBQ10 gene promoter, with SV40 NLS at the N-terminal and nucleoplasmin NLS at the C-terminal.DepositorInsertpcoCasphi-2
UseCRISPRExpressionPlantPromoterpUBQ10Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENmRFPCNAL2 pc1054
Plasmid#167567PurposeThe fusion protein contains a SV40 NLS followed by mRFP, linker and human PCNA.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only