We narrowed to 4,418 results for: DUR
-
Plasmid#103878Purposefull-length human b2 with tension sensor at b2_743DepositorInsertfull-length human b2 with tension sensor at b2_743 (ITGB2 Human)
UseTagstension sensor moduleExpressionMutationPromoterAvailable sinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
Djun - sense
Plasmid#38337DepositorInsertdjun (Jra Fly)
UseTagsExpressionInsectMutationPromoterHsp70Available sinceAug. 29, 2012AvailabilityAcademic Institutions and Nonprofits only -
pIRES-EGFP-TPD52
Plasmid#172460PurposeExpression of untagged Tumor Protein D52 (TPD52) and GFPDepositorInsertTPD52 (TPD52 Human)
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceAug. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
YFP-Rac1(H40,L61)
Plasmid#11403DepositorInsertras-related C3 botulinum toxin substrate 1 (RAC1 Human)
UseTagsYFPExpressionMammalianMutationObtained with Glutamine 61 mutated to Leucine. Th…PromoterAvailable sinceFeb. 21, 2007AvailabilityAcademic Institutions and Nonprofits only -
pCVL TAL(Nd154C63) SFFV Age-Xho/Xba-Sal linkers
Plasmid#50421PurposepTAL plasmid for cloning of megaTALs or other TAL-fusions and expression in mammalian cells. RVDs are cloned between Age-Xho sites and meganuclease/fusion is cloned between Xba-Sal sites.DepositorTypeEmpty backboneUseLentiviral and TALENTagsExpressionMammalianMutationPromoterSFFVAvailable sinceMay 23, 2014AvailabilityAcademic Institutions and Nonprofits only -
PB-CAG-HRKI(Haunt P-Inr2-cDNA KI)
Plasmid#92163PurposeFor lncRNA CAG promoter homologue recombination mediated knockinDepositorInsertHaunt CAG KI homology arms
UseOtherTagsExpressionMutationPromoterAvailable sinceFeb. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
GTL-ir
Plasmid#81102PurposeGene Tagging vector LEU/iRFP - Plasmid for tandem infrared RFP (tdiRFP) labeling of endogenous proteins with a LEU selection marker, originating from pSIVl (ID:81090)DepositorInserttdiRFP
UseCre/LoxTagstdiRFPExpressionYeastMutationcodon optimized second iRFP to avoid internal rec…PromoterAvailable sinceNov. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSR04
Plasmid#69151Purposeread-outloxP mCherry to GFP switch, with eft-1::tagBFP::tbb-2UTR as gene of interest for integration on cxtTi10816, Mos Chr IVDepositorInsertsmCherry
TagBFP
eGFP
UseCre/Lox; MossciTagsExpressionWormMutationcodon-optimzed index 1.0Promotereef-1A.1 (eft-3) and rps-27Available sinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
Djun - antisense
Plasmid#38338DepositorInsertdjun (Jra Fly)
UseTagsExpressionInsectMutationPromoterHsp70Available sinceAug. 29, 2012AvailabilityAcademic Institutions and Nonprofits only -
p413TEF-CARKL
Plasmid#51747Purposeoverexpression of mouse Sedoheptulokinase (CARKL, SHPK) in yeastDepositorInsertSHPK (Shpk Mouse)
UseTagsExpressionYeastMutationPromoterTEF1Available sinceMarch 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorInsertd5-HT2BR gRNA1 (CG42796 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorInsertd5-HT2BR gRNA2 (CG42796 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorInsertdSERT gRNA1 (SerT Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorInsertdSERT gRNA2 (SerT Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT7R-7xGFP11-HA
Plasmid#221836PurposePlasmid for generating 10xUAS-5-HT7R-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorInsert5-HT7R (5-HT7 Fly)
UseTags7xGFP11-HAExpressionInsectMutationPromoterhsp70Available sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CaMKII-RFP-p2A-DAAO-NES
Plasmid#238918PurposeMammalian expression of DAAO with a nuclear export signal and RFP as a reporter in excitatory neuronsDepositorInsertRFP-p2A-DAAO-NES
UseAAVTagsExpressionMammalianMutationPromoterCaMKIIalfaAvailable sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CMV-RFP-p2A-DAAO-NES
Plasmid#238920PurposeExpression of DAAO with a nuclear export signal and RFP as a reporter in mammalian cellsDepositorInsertRFP-p2A-DAAO-NES
UseAAVTagsExpressionMammalianMutationPromoterCMVAvailable sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-miR30-shJAG1 #1
Plasmid#171196PurposeRetroviral vector for U6 promoter driven expression empty miR30 based shJAG1 #1 (to be used in conjunction with Phoenix packaging cells).DepositorInsertshJAG1 #1
UseRetroviralTagsExpressionMammalianMutationPromoterU6Available sinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-miR30-shJAG1 #4
Plasmid#171197PurposeRetroviral vector for U6 promoter driven expression empty miR30 based shJAG1 #4 (to be used in conjunction with Phoenix packaging cells).DepositorInsertshJAG1 #4
UseRetroviralTagsExpressionMammalianMutationPromoterU6Available sinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-Nova1-GFP
Plasmid#217033PurposeOverexpression of Nova in DRG neurons promotes the "mature" splicing pattern observed in CNS neuronsDepositorInsertNova1 (Nova1 Mouse)
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only