We narrowed to 28,981 results for: Tat
-
Plasmid#250236PurposeAAV expressing light-activatable FGFR1 (optoFGFR1-HA) under the CaMKIIα promoter for excitatory-neuron-specific activationDepositorAvailable SinceJan. 16, 2026AvailabilityAcademic Institutions and Nonprofits only
-
pAvA139
Plasmid#248145Purposemutated LuxR transcriptional activator for expression in yeast: fused with Gal4 activation domain with 'gen1' mutationsDepositorInsertluxR (gen1 mutations)
UseIntegration vectorTagsGal4 activation domain and nuclear localization s…ExpressionYeastMutationGal4_AD: N24K, P41 (CCA→CCG), N46D, T92S, V98 (GT…PromoterpPGK1Available SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-3xFLAG-NRF1-FL_WobbleMut
Plasmid#237455PurposeVector for generating Flp-In cell lines allowing dox-inducible mammalian expression of 3xFlag-tagged full-length NRF1 isoform mutated to be resistant to NRF1 siRNADepositorInsertNRF1 full length
Tags3xFLAGExpressionMammalianPromoterCMV/TO inducible promoterAvailable SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-3xFLAG-NRF1-∆ex7_WobbleMut
Plasmid#237456PurposeVector for generating Flp-In cell lines allowing dox-inducible mammalian expression of 3xFlag-tagged NRF1 isoform lacking the alternative exon-7 (∆ex7) mutated to be resistant to NRF1 siRNADepositorInsertNRF1 ∆exon-7
Tags3xFLAGExpressionMammalianPromoterCMV/TO inducible promoterAvailable SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
pMAPLe4 PCMTD1
Plasmid#246503PurposeRecombinant protein expression of PCMTD1DepositorInsertProtein-L-isoaspartate O-methyltransferase domain-containing protein 1 (PCMTD1 Human)
TagsHis-tagExpressionBacterialMutationResidue 312 is Isoleucine in this plasmid but occ…Available SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-shLRRK2-mCherry-CAAX
Plasmid#227686PurposeMembrane tethered mCherry and shRNA targeting LRRK2DepositorInsertLRRK2 shRNA (Lrrk2 Mouse)
ExpressionMammalianAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA377 - pBA904 Puro-T2A-GFP CD55 CRISPRa guide 1 (pRCA360 backbone)
Plasmid#238168PurposeLentiviral CRISPR guide vector expressing CD55 targeting sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV_G-PTEN_4A
Plasmid#227434PurposeExpresses the G-PTEN sensor with a 4A mutationDepositorInsertG-PTEN 4A (Pten Rat)
TagsmEGFP and sREAChExpressionMammalianMutation4A mutation.PromoterCMVAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRpuro-sgSEC24D
Plasmid#231565PurposepLentiCRISPR expression vector for Cas9 and gRNA targeting human SEC24D (Puromycin selection marker)DepositorAvailable SinceFeb. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
Cdk13_intron3_sg3_pX458
Plasmid#127338PurposesgRNA that cuts within intron 3 of mouse CDK13 genomic locus- guide #3DepositorInsertMouse Cdk13 Intron 3 sgRNA
UseCRISPR and Mouse TargetingPromoterU6 PromoterAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Cdk13_intron4_sg4_pX330
Plasmid#127341PurposesgRNA that cuts within intron 4 of mouse CDK13 genomic locus- guide #4DepositorInsertMouse Cdk13 Intron 4 Targeting sgRNA
UseCRISPR and Mouse TargetingPromoterU6 PromoterAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG_SRGAP2A_GAP(R527L_K566A)
Plasmid#222617PurposeExpresses full length SRGAP2 with R527L, K566A mt in the Rac1-specific GAP domain that abrogates the GTPase activating function of SRGAP2 without locking the GAP-domain in a form bound to Rac1-GDP.DepositorInsertSRGAP2 (SRGAP2 Human)
TagsEGFPExpressionMammalianMutationPoint mutations R527L and K566A (Rac1-specific GA…Available SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-humanEC1.45_min1-2_4XEboxMutant
Plasmid#215026PurposeFirefly luciferase enhancer reporter plasmid with minimal enhancer regions 1 and 2 (min1 and min2) from SOX9 enhancer cluster EC1.45 with E-boxes mutatedDepositorInsertMinimal enhancer regions 1 and 2 (min1 and min2) from SOX9 enhancer cluster EC1.45 with E-boxes mutated
UseLuciferaseMutation4X E-box mutations within Coordinator motifsPromoterSV40Available SinceMarch 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1+FLAG-KrasnatQ61R
Plasmid#206843PurposeTo express mouse Kras encoded by native mouse codons and with a Q61R mutation with an N-terminal FLAG tag.DepositorAvailable SinceOct. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMIR218-2_nt5G>U
Plasmid#174009PurposemiR218 nt5 point mutation in SLIT3DepositorAvailable SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-PKAcat(G1A)-mCherry
Plasmid#181852PurposemCherry-tagged PKA catalytic subunit lacking N-terminal myristoylation site; for mammalian expression.DepositorInsertPKAcat-mCherry (PRKACA Human)
TagsmCherryExpressionMammalianMutationGlycine residue immediately after start site in P…PromoterCMVAvailable SinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST17-cDAXX-0SB
Plasmid#169730PurposeBacterial expression of N-terminally 6His tagged cDAXX-0SBDepositorInsertcDAXX-0SB (DAXX Human)
Tags6 HisExpressionBacterialMutationComprises residues 495-741 and has the major SB m…PromoterT7Available SinceJune 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGMC00004
Plasmid#166721PurposesgRNA against mouse KitlDepositorAvailable SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmTral-FDF-ADA_C
Plasmid#146039PurposeInsect Expression of DmTral-FDF-ADADepositorInsertDmTral-FDF-ADA (tral Fly)
ExpressionInsectMutationFDF to ADA (407-409) mutation. Additionally, thre…Available SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
Donor-CD55-NeoR
Plasmid#153551PurposeUsed as a donor vector for the targeted knock-in of a CD55 mutation. This plasmid carries a neomycin resistance gene cassetteDepositorInsertmutant CD55 (a 1415-bp fragment from intron 3, exon 4 and intron 4, with a 1-bp mutation in exon 4), divided into 5' and 3' arms
UseAAV and Cre/Lox; Donor plasmid/targeting vectorTagsN/AMutationa 1-bp mutation in exon 4PromoterNo promoterAvailable SinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
Donor-PIGA-NeoR
Plasmid#153549PurposeUsed as a donor vector for the targeted knock-in of a PIGA mutation. This plasmid carries a neomycin resistance gene cassetteDepositorInsertmutant PIGA (a 1,991-bp fragment from intron 5 and exon 6 with a 3-bp mutation in exon 6), divided into 5' and 3' arms
UseAAV and Cre/Lox; Donor plasmid/targeting vectorTagsN/AMutationa 3-bp mutation in exon 6PromoterNo promoterAvailable SinceDec. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
FUG-PtenW274L
Plasmid#140736PurposeLentiviral vector to overexpress the autism-associated PTEN mutation W274L as a GFP-PTEN fusion proteinDepositorInsertGFP-PTEN (PTEN Human)
UseLentiviralTagsGFPExpressionMammalianMutationW274LPromoterhUbiCAvailable SinceMay 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
FUG-PtenD252G
Plasmid#140735PurposeLentiviral vector to overexpress the autism-associated PTEN mutation D252G as a GFP-PTEN fusion proteinDepositorInsertGFP-PTEN (PTEN Human)
UseLentiviralTagsGFPExpressionMammalianMutationD252GPromoterhUbiCAvailable SinceMay 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
FUG-PtenH93R
Plasmid#140733PurposeLentiviral vector to overexpress the autism-associated PTEN mutation H93R as a GFP-PTEN fusion proteinDepositorInsertGFP-PTEN (PTEN Human)
UseLentiviralTagsGFPExpressionMammalianMutationH93RPromoterhUbiCAvailable SinceMay 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPN432
Plasmid#137870PurposeExpression of gRNA a3 targeting TCF4 for CRISPRa; U6 promoterDepositorAvailable SinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
MBP-hnRNPA2_LC_R191K_R201K_R216K_R254K
Plasmid#104467Purposeexpress MBP hnRNPA2 LC with 4 R to K mutationsDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLuc-Optop38i-lsm
Plasmid#89747PurposeExpression of light-regulated p38 inhibitor, firefly luciferase-fused, lit-state mutant photosensor (AsLov2Ja.I539E), inhibitor MK3BD3-13FDepositorInsertOptop38i lit-state mutant
UseLuciferaseTagsFirefly luciferaseExpressionMammalianMutationI539E mutation of AsLov2JalphaPromoterCMVAvailable SinceAug. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLuc-OptoJNKi-lsm
Plasmid#89746PurposeExpression of light-regulated JNK inhibitor, firefly luciferase-fused, lit-state mutant photosensor (AsLov2Ja.I539E), inhibitor JIP11DepositorInsertOptoJNKi lit-state mutant
UseLuciferaseTagsFirefly luciferaseExpressionMammalianMutationI539E mutation of AsLov2JalphaPromoterCMVAvailable SinceAug. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLuc-OptoJNKi-dsm
Plasmid#89745PurposeExpression of light-regulated JNK inhibitor, firefly luciferase-fused, dark-state mutant photosensor (AsLov2Ja.C450A), inhibitor JIP11DepositorInsertOptoJNKi dark-state mutant
UseLuciferaseTagsFirefly luciferaseExpressionMammalianMutationC450A mutation of AsLov2JalphaPromoterCMVAvailable SinceAug. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMDC43-FIT2-N[80]A
Plasmid#96995PurposeExpress GFP-tagged mutated mouse FIT2 gene in plants.DepositorInsertMmFIT2 (Fitm2 Mouse)
TagsGFPExpressionPlantMutationAmino acid residue 80 was mutated (N[80]A). Mutat…Promoter35SAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-hSOX10-G1238A-C1240T
Plasmid#24739DepositorInsert(sex determining region Y)-box 10 (SOX10 Human)
UseGateway donor vectorMutationG replaced with A at position 1238 and C replaced…Available SinceMay 18, 2010AvailabilityAcademic Institutions and Nonprofits only -
pRRLHygro-pEF1a-p53ashL344A-mKate2-splitmVenusC
Plasmid#69585PurposeExpresses mutated p53-L344A tagged with mKate2 and split C-term mVenusDepositorInsertp53-L344A (TP53 Human)
UseLentiviralTagsmKate2 and split mVenus - C termExpressionMammalianMutationp53 L344A mutation that prevents tetramerization …PromoterEF1alphaAvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMXS-mitoGshF-blasticidin
Plasmid#210314PurposeExpresses mitochondrially targeted, humanized Streptococcus thermophilus GshF in mammalian cellsDepositorInsertBifunctional glutamate-cysteine ligase/glutathione synthetase GshF (gshAB Streptococcus thermophilus)
UseRetroviralTagsFLAG peptide, Homo sapiens ACO2 mitochondrial tar…MutationCodon optimized for expression in human cellsAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
TFORF3358
Plasmid#144834PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
AID-C12*-dCas9-BE4max
Plasmid#216731PurposeExpresses a BE4max base editing construct comprised of the hyperactive AID-C12* and dCas9 (Cas9 with D10A and H840A mutations) in mammalian cells.DepositorAvailable SinceApril 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-M13-6His-KIF1C-GFP
Plasmid#130975PurposeExpression of 6His-KIF1C-GFP in insect cells for protein purification.DepositorInsertKIF1C-GFP (KIF1C Human)
Tags6His and GFPExpressionInsectMutation5 silent mutations that make this construct RNAi …PromoterPolyhedrinAvailable SinceOct. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-eHGT_78h-Cre_PEST
Plasmid#231791PurposeExpresses Cre in excitatory neurons; Cre expression is attenuated by PEST sequence.DepositorInsertCre
UseAAVTagsPESTPromoterminBetaGlobinAvailable SinceNov. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
plenti-ef1a-dCasRx-FTO-HA-T2A-BSD
Plasmid#177120PurposedCasRx mediated RNA tethering of FTODepositorInsertdCasRx-FTO
UseLentiviralTagsHA and SV40 NLSMutationdCasRX contains R239A/H244A/R858A/H863A mutations…PromoterEf1aAvailable SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA.3.1.ADRB2-NP
Plasmid#134376PurposeNanoluc complementation assay. Expression of adrenoceptor beta 2 fused at C termimus with Natural peptide (NP) of NanoLuc. Addition of signal sequence and Flag epitope at N terminus of ADRB2.DepositorInsertADRB2-NP (ADRB2 Human)
TagsFlag, natural peptide of nanoluciferase, and sign…ExpressionBacterial and MammalianPromoterT7Available SinceAug. 3, 2020AvailabilityAcademic Institutions and Nonprofits only