We narrowed to 3,281 results for: phage
-
Plasmid#160641PurposeModule for estradiol-inducible exp of the PhiC31 integrase gene. Includes TU for constitutive exp of an estradiol-inducible transcription activator and TU for estradiol-inducible exp of PhiC31.DepositorInsertERLexABDGal4AD / PhiC31
UseSynthetic BiologyExpressionPlantMutationBsaI and BsmBI sites removedPromoterPnosAvailable SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAX1_HS_lexA(Ind-)
Plasmid#225199PurposeUsed to create a non-inducible lexA by introducing a G85D mutation in E. coli HSDepositorInsertlexA homology arms
ExpressionBacterialMutationlexA G85DAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETcon-pGAL1-Aga2-Amyloid β42-c_myc
Plasmid#225223PurposeYeast optimized human Amyloid β42 fused with aga2 protein gene under gal1 promoter for the expression of Amyloid β42 in yeast surface display.DepositorInsertsTagsHA Tag and c-myc TagExpressionYeastPromoterGAL1Available SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETcon-pGAL1-Aga2-α-Synuclein-c_myc
Plasmid#225222PurposeYeast optimized human alpha synuclein fused with aga2 protein gene under gal1 promoter for the expression of alpha synuclein in yeast surface display.DepositorInsertsα-Synuclein
Aga2
TagsGS linker, HA Tag, and c-myc TagExpressionYeastPromoterGAL1Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 Register 1/3 Tnos:YFP:5'UTR (GB1507)
Plasmid#160583PurposePart 1/3 for assembly of site-specific recombination based Registers. Composed of the reversed sequences of the TNos terminator,YFP CDS and 5' UTR of 35S promoter (TNos:YFP:5'UTR)DepositorInsertYFP
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUPD 5'UTR:YFP:Tnos (GB1483)
Plasmid#160557PurposePart 3/3 for assembly of site-specific recombination based Registers. Composed of the 5'UTR sequence of 35S promoter, coding sequence of YFP and NOS terminator (5'UTR:YFP:TNos)DepositorInsert5'UTR:YFP:Tnos
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 Assembly Register 3/3 Part - 5'UTR:Luc:Tnos (GB1500)
Plasmid#160581PurposePart 3/3 for assembly of site-specific recombination based Registers. Composed of the 5'UTR sequence of 35S promoter, coding sequence of Luc and NOS terminatorDepositorInsertLuc
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA1(CTD)-NLS(SV40) (KAC438)
Plasmid#133796PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA1 (truncated C-terminal domain only) with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA1 (truncated C-terminal domain only)
TagsNLS(SV40)ExpressionMammalianMutationC-terminal domain onlyPromoterCMV and T7Available SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA1(T114A/F115A)-NLS(SV40) (KAC688)
Plasmid#133798PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA1(T114A/F115A) with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA1(T114A/F115A)
TagsNLS(SV40)ExpressionMammalianMutationT114A/F115APromoterCMV and T7Available SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti NbALFA-mNeonGreen puro
Plasmid#193973Purposelentivector coding for mNeonGreen fused to a nanobody targeting the ALFA tag, puromycin resistanceDepositorInsertNbALFA-mNeonGreen
UseLentiviralTagsmNeonGreenExpressionMammalianPromoterEF1aAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti NbALFA-mNeonGreen hygro
Plasmid#193974Purposelentivector coding for mNeonGreen fused to a nanobody targeting the ALFA tag, hygromycin resistanceDepositorInsertNbALFA-mNeonGreen
UseLentiviralTagsmNeonGreenExpressionMammalianPromoterEF1aAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti NbALFA-miRFP680 hygro
Plasmid#193969Purposelentivector coding for miRFP680 fused to a nanobody targeting the ALFA tag, hygromycin resistanceDepositorInsertNbALFA-miRFP680
UseLentiviralTagsmiRFP680ExpressionMammalianPromoterEF1aAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOpen-T4-BGT
Plasmid#165530PurposeT4 Phage beta-glucosyltransferasetransfers the glucose moiety of UDP-Glc to the 5-hmC residues in double-stranded DNA.DepositorInsertT4-BGT
UseSynthetic BiologyAvailable SinceAug. 5, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
C98m
Plasmid#121002PurposeMoClo golden gate assembly CD part for Gp2 (RNA polymerase inhibitor from T7 phage; lethal to host when expressed). Please see Supplemental Documents for annotated Genbank file.DepositorInsertGp2 toxin
UseSynthetic BiologyAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti NbALFA-miRFP680 puro
Plasmid#193972Purposelentivector coding for miRFP680 fused to a nanobody targeting the ALFA tag, puromycin resistanceDepositorInsertNbALFA-miRFP680
UseLentiviralTagsmiRFP680ExpressionMammalianPromoterEF1aAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
v3em-Cterm-PE6c-dualU6-Rosa26-twinPE-attB
Plasmid#207861PurposeAAV genome encoding C-terminal PE6c and U6 expression cassettes for Rosa26 twinPE pegRNA pairsDepositorInsertNpuC-Cterm-PE6c-dualU6-Rosa26-twinPE-attB
UseAAVMutationSee ManuscriptPromoterCbhAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
v3em-Cterm-PE6d-dualU6-Dnmt1-PE3-loxP
Plasmid#207863PurposeAAV genome encoding C-terminal PE6d and U6 expression cassettes for Dnmt1 PE3 pegRNA and ngRNADepositorInsertNpuC-Cterm-PE6d-dualU6-Dnmt1-PE3-loxP
UseAAVMutationSee ManuscriptPromoterCbhAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
Cre-IRES-PuroR
Plasmid#30205PurposeLentiviral coexpression of Cre and puromycin from the human EF1a promoterDepositorInsertCre recombinase (cre Enterobacteria phage P1)
UseCre/Lox and LentiviralExpressionMammalianPromoterEF1alphaAvailable SinceApril 12, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE6b
Plasmid#207852PurposeMammalian expression of PE6b prime editorDepositorInsertPE6b
TagsSV40 bpNLS and SV40 bpNLS, c-Myc NLSExpressionMammalianMutationTf1rt(P70T, G72V, S87G, M102I, K106R, K118R, I128…Available SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only