We narrowed to 3,355 results for: phage
-
Plasmid#184060Purposecyclofen-inducible CRE activation in zebrafish transient transgenicDepositorInsertCRE-ERT2
UseZebrafish transient transgenesisMutationERT2: G400V, M543A, L544A, deleted 1-281;PromoterZf-Hsp70-4Available SinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 PhiC31 RL (attR:P35S:TMtb:attL) (GB1506)
Plasmid#160582Purpose35S promoter inverted sequence and the Mtb terminator flanked by two opposing PhiC31 site-specific recombination sites (attR and attL)DepositorInsertattR:P35S:TMtb:attL
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJT175_GalL_A3A(Y130F)Δ186-BE3
Plasmid#145124PurposeExpressing base editor A3A(Y130F)Δ186-BE3 in yeast cellsDepositorInsertA3A(Y130F)Δ186-BE3
UseCRISPRExpressionYeastMutationA3A(Y130F; 1-186AA); spCas9(D10A)PromoterGalLAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA1(T16A)-NLS(SV40) (KAC511)
Plasmid#133797PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA1(T16A) with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA1(T16A)
TagsNLS(SV40)ExpressionMammalianMutationT16APromoterCMV and T7Available SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA1-Leu-NLS(SV40) (KAC440)
Plasmid#133799PurposeCMV and T7 promoter expression plasmid for human codon optimized Leu-AcrIIA1 with C-terminal NLS (SV40)DepositorInserthuman codon optimized Leu-AcrIIA1
TagsNLS(SV40)ExpressionMammalianMutationn/aPromoterCMV and T7Available SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA1-Eriv-NLS(SV40) (KAC442)
Plasmid#133800PurposeCMV and T7 promoter expression plasmid for human codon optimized Eriv-AcrIIA1 with C-terminal NLS (SV40)DepositorInserthuman codon optimized Eriv-AcrIIA1
TagsNLS(SV40)ExpressionMammalianMutationn/aPromoterCMV and T7Available SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTSlb-R756S
Plasmid#60730PurposeExpresses both fragments of T7 RNAP split at position 179. The N-terminal fragment is driven by PLac while the C-terminal fragment is driven by PBAD. C-terminal fragment has the point mutations R756SDepositorInsertsResidues 1-179 of split T7 RNAP
Residues 180-880 of split T7 RNAP
UseSynthetic BiologyExpressionBacterialMutationResidues 1-180 of split T7 RNAP and Residues 180-…Available SinceJan. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTSara-R756S
Plasmid#60725PurposeExpresses both fragments of T7 RNAP split at position 179. Both fragments are driven by PBAD. The C-terminal fragment has the point mutation R756S. Contains a constitutive araC ORFDepositorInsertsResidues 1-179 of split T7 RNAP
Residues 180-880 of split T7 RNAP
UseSynthetic BiologyExpressionBacterialMutationResidues 1-180 of split T7 RNAP and Residues 180-…Available SinceDec. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pTSara-Q758C
Plasmid#60724PurposeExpresses both fragments of T7 RNAP split at position 179. Both fragments are driven by PBAD. The C-terminal fragment has the point mutation Q758C. Contains a constitutive araC ORFDepositorInsertsResidues 1-179 of split T7 RNAP
Residues 180-880 of split T7 RNAP
UseSynthetic BiologyExpressionBacterialMutationResidues 1-180 of split T7 RNAP and Residues 180-…Available SinceDec. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMAL-c2X_MBP-CLmN-H6
Plasmid#234487PurposeMaltose binding protein N-terminally fused to His-tagged CLmN split inteinDepositorInsertN-terminal Fragment of the CLm Split Intein
TagsHexahistidine Tag and Maltose Binding Protein (MB…ExpressionBacterialMutationT69K, F75H, M118N within the N-terminal fragment …Available SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET22b-T7-6h-GST-α-Synuclein
Plasmid#225224PurposeAlpha synuclein gene fused with gst gene under t7 promoter for bacterial expression of alpha synuclein protein.DepositorInsertsGST
α-Synuclein
Tags6xHis Tag and TEV Cleavage SiteExpressionBacterialPromoterT7Available SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETcon-pGAL1-Aga2-Amyloid β42-c_myc
Plasmid#225223PurposeYeast optimized human Amyloid β42 fused with aga2 protein gene under gal1 promoter for the expression of Amyloid β42 in yeast surface display.DepositorInsertsTagsHA Tag and c-myc TagExpressionYeastPromoterGAL1Available SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET42b-BE3
Plasmid#87437PurposeExpresses BE3-NLS with an N-terminal His Tag (His6) for bacterial expressionDepositorAvailable SinceJune 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2Cre
Plasmid#82415PurposeLentiviral vector expressing Cre recombinase alongside Cas9 and an sgRNA cloning siteDepositorInsertCre Recombinase
UseCRISPR, Cre/Lox, and LentiviralMutationMutated BsmBI cut sitePromoterEFS (P2A)Available SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
MCP-Rep-X-RT∆R
Plasmid#239384PurposeFor circular RNA-mediated inverse prime editor using MCP-Rep-X-M MLV-RT∆RNase H in HEK294T cellsDepositorInsertMCP, Rep-X, M-MLV-RT(∆RNase H)
UseCRISPRTagsBPNLSExpressionMammalianMutation∆RNase H in M-MLV RTPromoterCMVAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMC059-HisMS2_PLP_NucPhos_pac
Plasmid#155039PurposeGeneration of MS2 Virus Like Particles packaged with the sequence for the SARS-CoV-2 Nucleocapsid Phosphoprotein geneDepositorInsertsMaturation Protein
Coat Protein Dimer
Nucleocapsid Phosphoprotein
ExpressionBacterialMutationRemove TypeIIs Restriction SitesPromoterT7Available SinceSept. 9, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMC060-HisMS2_PLP_Env_pac
Plasmid#155040PurposeGeneration of MS2 Virus Like Particles packaged with the sequence for the SARS-CoV-2 Envelope GeneDepositorInsertsMaturation Protein
Coat Protein Dimer
Envelope Gene
ExpressionBacterialMutationRemove TypeIIs Restriction SitesPromoterT7Available SinceSept. 9, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
ABE8e(TadA-8e K20A R21A)
Plasmid#138496PurposeA-to-G base editorDepositorInsertecTadA(8e K20A R21A)-nSpCas9
ExpressionMammalianMutationTadA-8e K20A R21AAvailable SinceMarch 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDGB3_Omega1_Pnos:ER:lexABD:GAL4AD:T35s-OplexA:mini35S:phi31:Tnos (GB1677)
Plasmid#160641PurposeModule for estradiol-inducible exp of the PhiC31 integrase gene. Includes TU for constitutive exp of an estradiol-inducible transcription activator and TU for estradiol-inducible exp of PhiC31.DepositorInsertERLexABDGal4AD / PhiC31
UseSynthetic BiologyExpressionPlantMutationBsaI and BsmBI sites removedPromoterPnosAvailable SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only