We narrowed to 5,130 results for: CAPS
-
Plasmid#194674PurposeProtein production of the split HaloTag based calcium recorder Caprola_13 in bacteriaDepositorInsertCaprola_13
TagsHis-tag and Strep-tagExpressionBacterialPromoterT7Available SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEntry_SARS-CoV-1-Nucleocapsid
Plasmid#168852PurposeGateway-compatible Entry vectorDepositorInsertSARS-CoV-1-Nucleocapsid (N )
UseGateway-compatible entry vectorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pESC-NAT-LACap
Plasmid#80763PurposeExpresses truncated L-A capsid for curing satellite virusDepositorInsertL-A cDNA (L-A Cap)
ExpressionYeastPromoterPGK1Available SinceAug. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
iCAP-BI155-KanR
Plasmid#209527PurposeRepCap for AAV productionDepositorInsertAAV-BI155 Cap
ExpressionMammalianAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-PAL1C
Plasmid#196685PurposeRep/Cap plasmid for the production of PAL1C, an AAV capsid with CNS tropism in macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationPTQGTLR insert between amino acids 588 and 589 of…Promoterp41Available SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET-51b(+)-Caprola_09
Plasmid#194670PurposeProtein production of the split HaloTag based calcium recorder Caprola_09 in bacteriaDepositorInsertCaprola_09
TagsHis-tag and Strep-tagExpressionBacterialPromoterT7Available SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-CAPRIN1-3'UTR
Plasmid#136055PurposeCAPRIN1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCACGTTAGTGTCACAAATT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-M.Mus.2
Plasmid#196682PurposeRep/Cap plasmid for the production of M.Mus.2, an AAV capsid with CNS tropism in mice.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationREQQKLW insert between amino acids 588 and 589 of…Promoterp41Available SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEBTet-SNAP-CCCAP
Plasmid#136798PurposeMammalian expression of the centrosomal protein CCCAP N-terminally fused to SNAP-tagDepositorInsertSNAP-CCCAP (SDCCAG8 Synthetic, Human)
TagsFLAG-tag / His-tagExpressionMammalianPromoterCMV-TetO2Available SinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEGFP C1-Eps8 ∆cap
Plasmid#74786Purposemammalian expression of the capping activity mutant Eps8 fused to GFPDepositorAvailable SinceMay 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
CAP Z alpha 1 beta 1 CP
Plasmid#13451DepositorAvailable SinceDec. 22, 2006AvailabilityAcademic Institutions and Nonprofits only -
Ad-CBR (GFP/cAPC)
Plasmid#16576DepositorAvailable SinceJuly 3, 2008AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-CAPRIN1-CDS
Plasmid#136054PurposeCAPRIN1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CCTCAGCAGAACACTGGATTT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET-51b(+)-Caprola_14
Plasmid#194675PurposeProtein production of the split HaloTag based calcium recorder Caprola_14 in bacteriaDepositorInsertCaprola_14
TagsHis-tag and Strep-tagExpressionBacterialPromoterT7Available SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-51b(+)-Caprola_15
Plasmid#194676PurposeProtein production of the split HaloTag based calcium recorder Caprola_15 in bacteriaDepositorInsertCaprola_15
TagsHis-tag and Strep-tagExpressionBacterialPromoterT7Available SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTXB1-CRP/CAP
Plasmid#51563PurposeExpression of E. coli CRP/CAP for protein purification (Intein-chiting binding domain fussion, New England Biolabs pTXB1 backboneDepositorInsertCRP/CAP
TagsIntein-Chiting Binding DomaninExpressionBacterialAvailable SinceMarch 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-M.Mus.1
Plasmid#196681PurposeRep/Cap plasmid for the production of M.Mus.1, an AAV capsid with CNS tropism in mice.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationWVLPSGG insert between amino acids 588 and 589 of…Promoterp41Available SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MDV1B
Plasmid#196680PurposeRep/Cap plasmid for the production of MDV1B, an AAV capsid with CNS tropism in mice.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationKTVGTVY insert between amino acids 588 and 589 of…Promoterp41Available SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-PAL2
Plasmid#196691PurposeRep/Cap plasmid for the production of PAL2, an AAV capsid with CNS tropism in macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationPTQGTVR insert between amino acids 588 and 589 of…Promoterp41Available SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-fTCAP-GFP
Plasmid#22916DepositorInsertfugu titan cap promoter driving GFP
UseAAVExpressionMammalianAvailable SinceMay 25, 2010AvailabilityAcademic Institutions and Nonprofits only