We narrowed to 5,051 results for: CAPS;
-
Plasmid#136055PurposeCAPRIN1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCACGTTAGTGTCACAAATT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only
-
kiCAP-AAV-M.Mus.2
Plasmid#196682PurposeRep/Cap plasmid for the production of M.Mus.2, an AAV capsid with CNS tropism in mice.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationREQQKLW insert between amino acids 588 and 589 of…Promoterp41Available SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEBTet-SNAP-CCCAP
Plasmid#136798PurposeMammalian expression of the centrosomal protein CCCAP N-terminally fused to SNAP-tagDepositorInsertSNAP-CCCAP (SDCCAG8 Human, Synthetic)
TagsFLAG-tag / His-tagExpressionMammalianPromoterCMV-TetO2Available SinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEGFP C1-Eps8 ∆cap
Plasmid#74786Purposemammalian expression of the capping activity mutant Eps8 fused to GFPDepositorAvailable SinceMay 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBiT3.1-C_SCAP:1-905
Plasmid#211302PurposeMammalian expression of full-length human SCAP isoform 2. C-terminal HiBiT tag.DepositorInsertSCAP:M1-D905 (SCAP Human)
TagsGSSGGSSGVSGWRLFKKISExpressionMammalianMutationisoform 2. V798I natural variant (VAR_012203)PromoterCMVAvailable SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-CAPRIN1-CDS
Plasmid#136054PurposeCAPRIN1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CCTCAGCAGAACACTGGATTT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
Ad-CBR (GFP/cAPC)
Plasmid#16576DepositorAvailable SinceJuly 3, 2008AvailabilityAcademic Institutions and Nonprofits only -
CAP Z alpha 1 beta 1 CP
Plasmid#13451DepositorAvailable SinceDec. 22, 2006AvailabilityAcademic Institutions and Nonprofits only -
pET-51b(+)-Caprola_14
Plasmid#194675PurposeProtein production of the split HaloTag based calcium recorder Caprola_14 in bacteriaDepositorInsertCaprola_14
TagsHis-tag and Strep-tagExpressionBacterialPromoterT7Available SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-51b(+)-Caprola_15
Plasmid#194676PurposeProtein production of the split HaloTag based calcium recorder Caprola_15 in bacteriaDepositorInsertCaprola_15
TagsHis-tag and Strep-tagExpressionBacterialPromoterT7Available SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-M.Mus.1
Plasmid#196681PurposeRep/Cap plasmid for the production of M.Mus.1, an AAV capsid with CNS tropism in mice.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationWVLPSGG insert between amino acids 588 and 589 of…Promoterp41Available SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MDV1B
Plasmid#196680PurposeRep/Cap plasmid for the production of MDV1B, an AAV capsid with CNS tropism in mice.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationKTVGTVY insert between amino acids 588 and 589 of…Promoterp41Available SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-PAL2
Plasmid#196691PurposeRep/Cap plasmid for the production of PAL2, an AAV capsid with CNS tropism in macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationPTQGTVR insert between amino acids 588 and 589 of…Promoterp41Available SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTXB1-CRP/CAP
Plasmid#51563PurposeExpression of E. coli CRP/CAP for protein purification (Intein-chiting binding domain fussion, New England Biolabs pTXB1 backboneDepositorInsertCRP/CAP
TagsIntein-Chiting Binding DomaninExpressionBacterialAvailable SinceMarch 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-fTCAP-GFP
Plasmid#22916DepositorInsertfugu titan cap promoter driving GFP
UseAAVExpressionMammalianAvailable SinceMay 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
pEBTetBl-CLIP-CCCAP
Plasmid#136847PurposeMammalian expression of the centrosomal protein CCCAP N-terminally fused to CLIP-tagDepositorInsertCLIP-CCCAP (SDCCAG8 Human, Synthetic)
TagsFLAG-tag / His-tagExpressionMammalianPromoterCMV-TetO2Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCRII-Topo Semcap3
Plasmid#45874DepositorInsertSemcap3 in situ probe (Pdzrn3 Mouse)
UseIn situMutationcontains bp# 3184-3805 of AF127085.1Available SinceJuly 9, 2013AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-Alpha 49
Plasmid#244910PurposeRep/Cap plasmid for producing variant AAV-hCA4-Alpha 49DepositorInsertSynthetic construct producing AAV REP/CAP
UseAAVExpressionMammalianAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
iCAP-BI103-KanR
Plasmid#203537PurposeRepCap for AAV productionDepositorInsertAAV-BI103 Cap
UseAAVExpressionMammalianAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-CAPS1-mKate2
Plasmid#245360PurposeMammalian expression of C-terminal mKate2-tagged rat CAPS1 wild typeDepositorAvailable SinceOct. 29, 2025AvailabilityAcademic Institutions and Nonprofits only