We narrowed to 24,790 results for: SPR
-
Plasmid#128112PurposeAcrX expression in mammalian cells; AcrX is an engineered anti-CRISPR protein targeting S. aureus Cas9DepositorInsertAcrX (AcrIIC1 N3F/D15Q/A48I)
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterCMVAvailable SinceDec. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
TRIP13 H3.2 gRNA
Plasmid#90920Purpose3rd generation lentiviral gRNA plasmid targeting human TRIP13DepositorInsertTRIP13 (Guide Designation H3.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
AURKA A2.1 gRNA
Plasmid#90541Purpose3rd generation lentiviral gRNA plasmid targeting human AURKADepositorInsertAURKA (Guide Designation A2.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_CEBPG_1
Plasmid#86344PurposeEncodes gRNA for 3' target of human CEBPGDepositorInsertgRNA against CEBPG (CEBPG Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
GMNN D1.2 gRNA
Plasmid#90696Purpose3rd generation lentiviral gRNA plasmid targeting human GMNNDepositorInsertGMNN (Guide Designation D1.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_CEBPA_2
Plasmid#86359PurposeEncodes gRNA for 3' target of human CEBPADepositorInsertgRNA against CEBPA (CEBPA Human)
UseCRISPRAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
UBA1 G5.3 gRNA
Plasmid#90932Purpose3rd generation lentiviral gRNA plasmid targeting human UBA1DepositorInsertUBA1 (Guide Designation G5.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pU6-gRNA-TAZ
Plasmid#86688PurposeExpresses a gRNA targeted to human TAZDepositorAvailable SinceMarch 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCas9GG
Plasmid#131009PurposeBackbone plasmid for generating CRISPR arrays for SpCas9 using CRATES. Contains a direct repeat and a RFP-dropout cassette.DepositorInsertsdirect repeat of SpCas9
promoter PJ23119
mRFP expression cassette
UseCRISPRExpressionBacterialPromoterBba_R0040 TetRAvailable SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
RNASEH2A B9.3 gRNA
Plasmid#90878Purpose3rd generation lentiviral gRNA plasmid targeting human RNASEH2ADepositorInsertRNASEH2A (Guide Designation B9.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pY036_ATP1A1_G5
Plasmid#86618PurposeExpresses the ATP1A1 G5 crRNA in combination with AsCpf1-3xHA to target ATP1A1 intron 4. U6-crRNA(ATP1A1 G5)-CBh-AsCpf1DepositorInsertATP1A1 G5 crRNA + AsCpf1-3xHA
UseCRISPR; Co-selection via hdr using ouabainTags3xHAExpressionMammalianPromoterCBhAvailable SinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
CLTC G10.4 gRNA
Plasmid#90635Purpose3rd generation lentiviral gRNA plasmid targeting human CLTCDepositorInsertCLTC (Guide Designation G10.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
SRSF2 A9.3 gRNA
Plasmid#90902Purpose3rd generation lentiviral gRNA plasmid targeting human SRSF2DepositorInsertSRSF2 (Guide Designation A9.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
SRSF2 A10.3 gRNA
Plasmid#90903Purpose3rd generation lentiviral gRNA plasmid targeting human SRSF2DepositorInsertSRSF2 (Guide Designation A10.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJZC39
Plasmid#62333PurposesgRNA + 1x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 1x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
Zebrafish-gRNA-0001
Plasmid#42241PurposegRNA targeted to zebrafish gene apoeaDepositorAvailable SinceJan. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCfB3053(gRNA X-2, XI-5, XII-4)
Plasmid#73295PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at sites X-2, XI-5, and XII-4DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
LIN52 D5.4 gRNA
Plasmid#90734Purpose3rd generation lentiviral gRNA plasmid targeting human LIN52DepositorInsertLIN52 (Guide Designation D5.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX330_MED13_iso1_1
Plasmid#135751PurposeEncodes gRNA for 3' target of human MED13_iso1DepositorAvailable SinceJan. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
PPP2R5C B11.5 gRNA
Plasmid#90853Purpose3rd generation lentiviral gRNA plasmid targeting human PPP2R5CDepositorInsertPPP2R5C (Guide Designation B11.5)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
NUMA1 H11.2 gRNA
Plasmid#90808Purpose3rd generation lentiviral gRNA plasmid targeting human NUMA1DepositorInsertNUMA1 (Guide Designation H11.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
TUBB F2.4 gRNA
Plasmid#90925Purpose3rd generation lentiviral gRNA plasmid targeting human TUBBDepositorInsertTUBB (Guide Designation F2.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEG302_dCAS9-MQ1(C141S,S317A)_g4+g10+g18
Plasmid#172317PurposeCRISPR dCas9 directly fused to a catalytic inactive version of bacterial DNA methyltransferase MQ1 to target to the FWA locus with three guide RNAsDepositorInsertg18_U6_g10_U6_g4_U6_UBQ10_Ω_dCas9_MQ1(C141S,S317A)_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVMG0173_Cq-Actin5c-Cas9
Plasmid#169345PurposeExpression of Cas9 in Culex quinquefasciatus or other mosquitoesDepositorInsertpVMG0173_Cq-Actin5c-Cas9
UseCRISPRExpressionInsectPromoterCPIJ009808Available SinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
NUMA1 H12.2 gRNA
Plasmid#90809Purpose3rd generation lentiviral gRNA plasmid targeting human NUMA1DepositorInsertNUMA1 (Guide Designation H12.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pVMG0212_Cq-nanos-Cas9
Plasmid#169348PurposeExpression of Cas9 in Culex quinquefasciatus or other mosquitoesDepositorInsertpVMG0212_Cq-nanos-Cas9
UseCRISPRExpressionInsectPromoterCPIJ011551Available SinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVMG0213_Cq-vasa-Cas9
Plasmid#169347PurposeExpression of Cas9 in Culex quinquefasciatus or other mosquitoesDepositorInsertpVMG0213_Cq-vasa-Cas9
UseCRISPRExpressionInsectPromoterCPIJ009286Available SinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
CDC6 B5.1 gRNA
Plasmid#90596Purpose3rd generation lentiviral gRNA plasmid targeting human CDC6DepositorInsertCDC6 (Guide Designation B5.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
KMT5A H2.3 gRNA
Plasmid#90727Purpose3rd generation lentiviral gRNA plasmid targeting human KMT5ADepositorInsertKMT5A (Guide Designation H2.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
UNG D12.3 gRNA
Plasmid#90937Purpose3rd generation lentiviral gRNA plasmid targeting human UNGDepositorInsertUNG (Guide Designation D12.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
PRC1 G2.2 gRNA
Plasmid#90857Purpose3rd generation lentiviral gRNA plasmid targeting human PRC1DepositorInsertPRC1 (Guide Designation G2.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
PRC1 G1.2 gRNA
Plasmid#90856Purpose3rd generation lentiviral gRNA plasmid targeting human PRC1DepositorInsertPRC1 (Guide Designation G1.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
CDC6 B6.1 gRNA
Plasmid#90597Purpose3rd generation lentiviral gRNA plasmid targeting human CDC6DepositorInsertCDC6 (Guide Designation B6.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
ORC1 G2.1 gRNA
Plasmid#90821Purpose3rd generation lentiviral gRNA plasmid targeting human ORC1DepositorInsertORC1 (Guide Designation G2.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
SASS6 G1.3 gRNA
Plasmid#90884Purpose3rd generation lentiviral gRNA plasmid targeting human SASS6DepositorInsertSASS6 (Guide Designation G1.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
UAS-u(XL)Cas9
Plasmid#127386PurposeExpresses Cas9 at very low levelDepositorInsertuORF(XL)-Cas9
UseCRISPRExpressionInsectPromoterUASTAvailable SinceJune 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
ASPM A5.2 gRNA
Plasmid#90537Purpose3rd generation lentiviral gRNA plasmid targeting human ASPMDepositorInsertASPM (Guide Designation A5.2)
UseCRISPR and LentiviralPromoterU6Available SinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
MELK E5.2 gRNA
Plasmid#90766Purpose3rd generation lentiviral gRNA plasmid targeting human MELKDepositorInsertMELK (Guide Designation E5.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
ECT2 B1.4 gRNA
Plasmid#90674Purpose3rd generation lentiviral gRNA plasmid targeting human ECT2DepositorInsertECT2 (Guide Designation B1.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
ECT2 D6.1 gRNA
Plasmid#90673Purpose3rd generation lentiviral gRNA plasmid targeting human ECT2DepositorInsertECT2 (Guide Designation D6.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only