We narrowed to 6,012 results for: ATC
-
Plasmid#162080PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to VSVg-StrepTagII-HA
UseLentiviralTagsVSVg-StrepTagII-HAMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFastBacI-KDAC6
Plasmid#224346PurposeExpresses human KDAC6 (HDAC6) in insect cellsDepositorAvailable SinceOct. 22, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pU6-SCGB3A2_gRNA1-SpCas9-T2A-GFP
Plasmid#126698Purposeto express Cas9 from S. pyogenes with 2A-EGFP and sgRNA targeting human SCGB3A2 locus at the end of the endogenous coding sequenceDepositorInsertsgRNA targeting human SCGB3A2 locus
ExpressionMammalianPromoterHuman U6Available SinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
TRIM33 gRNA (BRDN0001162239)
Plasmid#77098Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM33DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBZCas13b-HEPN
Plasmid#89901PurposeBacterial expression for bzCas13b and crRNA with both HEPN domains mutated. New spacers can be cloned by digesting with BsaI.DepositorInsertCas13b
ExpressionBacterialMutationR116A/H121A/R1177A/H1182APromoterLacAvailable SinceMay 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
TBK1 gRNA (BRDN0001145663)
Plasmid#76361Purpose3rd generation lentiviral gRNA plasmid targeting human TBK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA2 gRNA (BRDN0001147334)
Plasmid#75732Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-HA-FLAG-AU1
Plasmid#162098PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to HA-FLAG-AU1
UseLentiviralTagsHA-FLAG-AU1MutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-VSVg-StrepTagII-ProtC
Plasmid#162099PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to VSVg-StrepTagII-ProtC
UseLentiviralTagsVSVg-StrepTagII-ProtCMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
Gal4-entry+NLS
Plasmid#128013PurposeVector containing the Gal4-entry expression cassette with SV40 NLS and a separate expression cassette driving mCherry via the traffic jam enhancerDepositorInsertGal4 DBD-SV40NLS-3x-Flag
UseGal4 entry vector with nls to generate tethering …TagsGal4-DBD-SV40NLS-3xFlagAvailable SinceAug. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAF197
Plasmid#135930PurposeAll-in-one Sleeping Beauty vector for Expression for Tasmanian devil CTLA4-Fc-mCherry fusion protein. Multiple cloning sites to swap genes-of-interest (i.e. CTLA4).DepositorInsertCTLA4 fused to IgG Fc and to mCherry
UseTransposonTagsmCherryExpressionMammalianPromoterEF1aAvailable SinceJan. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUDE710
Plasmid#103020Purposeexpression of a Cpf1 programming crRNA targeting ADE2 and HIS4 (crADE2-3 crHIS4-4.S)DepositorAvailable SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET28a-ybbr-HIS-ELP-ddFLN4-I27-XMod-Doc (wild type)
Plasmid#153442PurposeE. coli expression of Rc. XDocB wild-type construct containing ybbr tag, ELP linker and ddFLN4 and I27 fingerprint domains. This construct was designed for AFM measurements.DepositorInsertRc.XDocB
Tags3xELP linker, 6xHis, Titin I27, ddFLN4 fingerprin…ExpressionBacterialPromoterT7 promoterAvailable SinceSept. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1309a
Plasmid#87399PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgPtprd#2/Cre
Plasmid#173648PurposeExpresses a Ptprd-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Ptprd (Ptprd Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPN007
Plasmid#91575PurposeExpress sgRNA targeting human BCL11ADepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_1
Plasmid#155059PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA targeting TK1 using SpCas9 and HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
SIK2 gRNA (BRDN0001147148)
Plasmid#77140Purpose3rd generation lentiviral gRNA plasmid targeting human SIK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_SFRS7_exon_deletion_3
Plasmid#155071PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
PNKP gRNA (BRDN0001147028)
Plasmid#77162Purpose3rd generation lentiviral gRNA plasmid targeting human PNKPDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only