We narrowed to 9,048 results for: sgRNA
-
Plasmid#139321PurposePlasmid expressing a sgRNA to introduce BRCA2 V572I using base editingDepositorInsertsgRNA to insert BRCA2 V572I using base editing
ExpressionMammalianPromoterU6Available SinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
hPLD3-sgRNA-Cas9_mcherry
Plasmid#199342Purposeencodes sgRNA for human PLD3 KO, (target Exon 7) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-RFPExpressionMammalianPromoterhuman U6Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
hPLD4-sgRNA-Cas9_mcherry
Plasmid#199343Purposeencodes sgRNA for human PLD4 KO, (target Exon 5) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-mCherryExpressionMammalianMutationsgRNA: accagtagtatgaagccacgPromoterhuman U6Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX601-miniCMV-SaCas9-U6-LacZvsSaCas9 sgRNA
Plasmid#107049PurposeAll-in-one vectors expressing both SaCas9 and LacZ sgRNADepositorInsertSaCas9
UseAAV and CRISPRExpressionMammalianAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
GS2.1/EC
Plasmid#132568PurposesgRNA targeting A. thaliana pds3, regulated by A. thaliana U6 polIII promoter. Cas9 with a C-terminal mApple fusion, egg cell-specific expression. Hygromycin selectable marker (hpt).DepositorInsertegg cell promoter, Cas9-mApple, pds3 sgRNA
UseCRISPR and Synthetic BiologyExpressionPlantPromoterA. thaliana egg cell promoterAvailable SinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330-LAMP1
Plasmid#207787PurposeExpresses SpCas9 and a sgRNA targeting the C-terminus of LAMP1 for knock-in.DepositorInsertsgRNA Targeting C-terminus of LAMP1 (LAMP1 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-TOMM20
Plasmid#207789PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of TOMM20 for knock-in.DepositorInsertsgRNA Targeting C-terminus of TOMM20 (TOMM20 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceDec. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFA0055
Plasmid#131774PurposeGuide RNA (gCASS5a) and Cas9 expression plasmid for cleaving pFA6 series deletion cassettes, including KanMX, hphMX and natMX. Used to perform CRISPR-Swap of alleles.DepositorInsert20mer CASS5a guide (gCASS5a) and 5' sgRNA
ExpressionBacterial and YeastAvailable SinceOct. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMM763
Plasmid#68900PurposeIPTG-inducible CRISPRi vector targeting PcfiA (PR1), constiutive NanoLuc, pNBU2 backbone, AmpRDepositorInsertsdCas9
LacI
sgRNA
NanoLuc
MutationG1104EAvailable SinceOct. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMM731
Plasmid#68896PurposeIPTG-inducible CRISPRi vector targeting NanoLuc (NL1), constiutive NanoLuc, pNBU2 backbone, AmpRDepositorInsertsdCas9
LacI
sgRNA
NanoLuc
Available SinceOct. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-ANLN_sgRNA
Plasmid#183876PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and ANLN sgRNA for N-terminal tagging of anillin in human cells.DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_POP1 (pAVA3497)
Plasmid#239311PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting POP1DepositorInsertU6-driven sgRNA targeting POP1 (POP1 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_RPP29 (pAVA3545)
Plasmid#239314PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RPP29DepositorInsertU6-driven sgRNA targeting RPP29 (POP4 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_RPP14 (pAVA3507)
Plasmid#239317PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RPP14DepositorInsertU6-driven sgRNA targeting RPP14 (RPP14 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_RPP30 (pAVA3573)
Plasmid#239318PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RPP30DepositorInsertU6-driven sgRNA targeting RPP30 (RPP30 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pC131: pAAV.CMV-CasRx-VEGFA sgRNA array
Plasmid#203444PurposePlasmid expressing active RfxCas13d with an array of three VEGFA mRNA targeting gRNAsDepositorInsertsU6-VEGFA sgRNA array
RfxCas13d
UseAAVTagsHA and NLSExpressionMammalianPromoterCMV and U6Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
LCV2_PSMB2_sgRNA_1
Plasmid#155092Purposelentiviral plasmid expressing Cas9 and gRNA targeting PSMB2 (core essential gene)DepositorInsertPSMB2_sgRNA_1 (PSMB2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-hudTET1CD-T2A-mCherry(PX458)
Plasmid#129028Purposeinactivated control (targeted DNA demethylation),expression of dCas9-hudTET1CD-T2A-mCherry and cloning backbone for sgRNADepositorInsertdCas9-hudTET1CD, SgRNA cloning site
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A), catalytic domain huTET1 inact…PromoterCbH (for dCas9-hudTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJW1839
Plasmid#154325PurposesgRNA Destination Vector for SapTrapDepositorInsertSapTrap sgRNA (F+E) vector, R07E5.16 U6 promoter
UseCRISPRExpressionWormMutationF+E mutations in sgRNAAvailable SinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgSHOC2-2
Plasmid#86129PurposeLentiviral vector expressing Cas9 and an sgRNA targeting SHOC2DepositorAvailable SinceMay 15, 2017AvailabilityAcademic Institutions and Nonprofits only