We narrowed to 8,859 results for: sgRNA
-
Plasmid#132568PurposesgRNA targeting A. thaliana pds3, regulated by A. thaliana U6 polIII promoter. Cas9 with a C-terminal mApple fusion, egg cell-specific expression. Hygromycin selectable marker (hpt).DepositorInsertegg cell promoter, Cas9-mApple, pds3 sgRNA
UseCRISPR and Synthetic BiologyExpressionPlantPromoterA. thaliana egg cell promoterAvailable SinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJW1328
Plasmid#69488PurposesgRNA(F+E) targeting pha-1 (no Cas9); for co-conversion in C. elegansDepositorInsertsgRNA(F+E) targeting pha-1
ExpressionWormPromoterR07E5.16 U6 promoterAvailable SinceSept. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro-V2.0-sgHsAGO1_AH
Plasmid#148854PurposeMammalian Expression of HsAGO1-sgRNADepositorAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro-V2.0-sgHsNot1_AH
Plasmid#148856PurposeMammalian Expression of HsNot1-sgRNADepositorAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDIV515
Plasmid#177703PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
tRNA-sgRNA-tRNA
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), TDH3p (Candida lu…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
MSP2292
Plasmid#70707PurposeBacterial expression plasmid for KKH SaCas9 & sgRNA targeted to site 2: T7-humanSaCas9(E782K/N968K/R1015H)-NLS-3xFLAG-T7-Sa-sgRNA(84) #2DepositorInsertsmammalian codon-optimized KKH variant Staphylococcus aureus Cas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialMutationE782K, N968K and R1015H in SaCas9PromoterT7Available SinceDec. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDIV537
Plasmid#177704PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting KU70 homolog in D. hanseniiDepositorInsertsCas9
Nat
tRNA-sgRNA-tRNA
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), TDH3p (Candida lu…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
MSP2262
Plasmid#70703PurposeBacterial expression plasmid for Sa-dCas9 (D10A/H557A) & sgRNA targeted to site 1: T7-humanSadCas9-NLS-3xFLAG-T7-Sa-sgRNA(84) #1DepositorInsertsmammalian codon-optimized Staphylococcus aureus dCas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialMutationD10A & H557A in SaCas9PromoterT7Available SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
MSP2253
Plasmid#70704PurposeBacterial expression plasmid for KKH SaCas9 & sgRNA targeted to site 1: T7-humanSaCas9(E782K/N968K/R1015H)-NLS-3xFLAG-T7-Sa-sgRNA(84) #1DepositorInsertsmammalian codon-optimized KKH variant Staphylococcus aureus Cas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialMutationE782K, N968K and R1015H in SaCas9PromoterT7Available SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
MSP2279
Plasmid#70706PurposeBacterial expression plasmid for Sa-dCas9 (D10A/H557A) & sgRNA targeted to site 2: T7-humanSadCas9-NLS-3xFLAG-T7-Sa-sgRNA(84) #2DepositorInsertsmammalian codon-optimized Staphylococcus aureus dCas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialMutationD10A and H557A in SaCas9PromoterT7Available SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCRI012-pGEM-PacI-PU3-BsmbI-NotI
Plasmid#140204PurposeVector for cloning Cas9 sgRNA ( Step 1 of 2-step cloning). Contains AfU3 promoter driven sgRNA expression cassette flanked by PacI and NotI for further cloning in fungal vector.DepositorTypeEmpty backboneUseCRISPR and Synthetic Biology; Step 1 of cloning c…PromoterAspergillus fumigatus U3 (RNAPIII).Available SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV.5’eGFP/sgVIM
Plasmid#170548PurposeExpresses a sgRNA for 5' tagging to VIM and contains a cassette with eGFP without homology armsDepositorInsertsgRNA targeting 5'- end of VIM
UseCRISPR and LentiviralPromoterU6Available SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7gRNA-smyhc1_977
Plasmid#140867PurposesgRNA synthesis vector for smyhc1_977 (zebrafish slow myosin heavy chain 1).DepositorInsertzebrafish smyhc1_977 sgRNA for in vitro transcription (smyhc1 Synthetic, Zebrafish)
UseIn vitro transcription of sgrnasAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHvL1P4GA
Plasmid#112028PurposeExpresses sgRNA in barleyDepositorInsertTaU6-LacZ-sgRNA
UseUnspecifiedAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC57-sgDedd-1
Plasmid#74435PurposesgRNA expression vector for mouse Dedd gene targeting intron 5DepositorAvailable SinceMay 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
enDelIscB
Plasmid#247329PurposeVector encoding human codon-optimized engineered DelIscB driven by CAG promoter, optimized sgRNA (sgRNA-V5) driven by hU6, and mCherry driven by CMV promoterDepositorInsertpCAG_enDelIscB_npNLS_polyA_pU6_sgRNA_V5-BsaI_pCMV_mCherry
ExpressionMammalianAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pUC57-sgDedd-2
Plasmid#74436PurposesgRNA expression vector for mouse Dedd gene targeting intron 4DepositorAvailable SinceMay 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
p206-Switch-ON
Plasmid#217885PurposeRetroviral Switch-ON vector for sgRNA expression; U6-BbsIx2-SWITCH-ON-scaffold; neoRDepositorTypeEmpty backboneUseCRISPR, Cre/Lox, and RetroviralExpressionMammalianPromoterhU6Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
B52 + SMARCAL1 sgSTOP
Plasmid#100715PurposeB52 plasmid expressing SMARCAL1 sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting SMARCAL1 (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only