We narrowed to 4,269 results for: Bre;
-
Plasmid#182335PurposeExpresses human FOXA1 and miRFP670 via T2A linker under control of a CMV promoter.DepositorInsertForkhead Box A1 (FOXA1 Human)
UseTagsT2A-miRFP670ExpressionMammalianMutationPromoterCMVAvailable sinceApril 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
Str-KDEL_SBP-EGFP-CCR5-Cys3A
Plasmid#222313PurposeSynchronize the trafficking of CCR5-Cys3A from the ER.DepositorInsertStreptavidin-KDEL and CCR5-Cys3A fused to SBP-EGFP (CCR5 Human)
UseTagsExpressionMammalianMutationC321A, C323A, C324APromoterCMVAvailable sinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
SAM-DNMT3A-inactive+sgGFP
Plasmid#213169PurposeVector with sgGFP used as a negative control (inactive DNMT3A) for induction of global DNA methylation.DepositorInsertsgGFP
UseCRISPR, Lentiviral, and Synthetic BiologyTagsExpressionMammalianMutationPromoterE1Fa and U6Available sinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
SAM-DNMT3A-inactive+sgAAVS1_145
Plasmid#213170PurposeVector with sgAAVS1 used as a negative control (inactive DNMT3A) for induction of global DNA methylation.DepositorInsertsgAAVS1_145
UseCRISPR, Lentiviral, and Synthetic BiologyTagsExpressionMammalianMutationPromoterE1Fa and U6Available sinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac-mProser1-FLAG-IRES-Blast
Plasmid#226173PurposeExpresses full length mouse PROSER1 with 2X C-terminal FLAG tagsDepositorInsertProline Serine Rich protein 1 (Proser1 Mouse)
UseTags2X FLAGExpressionMammalianMutationPromoterAvailable sinceNov. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest17_hnRNPA1_YtoW
Plasmid#224253PurposeBacterial expression of N-terminally 6His-tagged hnRNPA1_YtoWDepositorInserthnRNPA1_YtoW (HNRNPA1 Human)
UseTags6xHisExpressionBacterialMutationY52W, Y59W, Y75W, Y81W, Y110W, Y120W, Y129WPromoterT7Available sinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pC1_oROS-HT_LF(C199S)
Plasmid#216412PurposeExpresses the loss-of-function mutation C199S of the genetically encoded, chemigenetic hydrogen peroxide sensor oROS-HT in mamalian cells.DepositorInsertoROS-HT_LF(C199S)
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pC1-lifeact-oROS-HT
Plasmid#216420PurposeTargeting of the chemigenetic, fluorescent peroxide sensor oROS-HT to actin filaments.DepositorInsertlifeact-oROS-HT
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-Dlx-SynaptoTAG
Plasmid#210729PurposeAAV vector for mapping synaptic projections. GABAergic neuron-specific Dlx promoter expresses EGFP-Synaptobrevin-2 to label synaptic terminals and Palm-tdTomato to label neuronal soma and axons.DepositorInsertEGFP-Synaptobrevin-2, P2A, Palm-tdTomato (tdTomato with Palmitoylation sequence) (Vamp2 Synthetic, Rat)
UseAAVTagsExpressionMutationPromoterDlxAvailable sinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR4 Ta-sro1 WWE-PARP
Plasmid#192548PurposepENTR plasmid Triticum aestivum sro1, amino acids 1-434, cultivar SR3, no stop codonDepositorInsertSIMILAR TO RCD ONE 1 (SRO1) WWE-PARP domains, cultivar Shanrong No. 3 (SR3)
UseGateway entry vectorTagsExpressionMutationPromoterAvailable sinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOPINF Ta-sro1 PARP
Plasmid#192549PurposeE. coli expression vector for Triticum aestivum sro1 PARP domain (amino acids 246-434)DepositorInsertSIMILAR TO RCD ONE 1 (SRO1) PARP domain, cultivar Shanrong No. 3 (SR3)
UseTagsHis6, 3C protease cleavage siteExpressionBacterial, Insect, and Mamm…MutationPromoterT7 promoterAvailable sinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pClgn1.1_Dcst1-3xHA
Plasmid#183540PurposeExpress Dcst1-3xHA under the mouse Clgn promoter.DepositorInsertDC-STAMP domain containing 1 (Dcst1 Mouse)
UseTagsHAExpressionMammalianMutationPromoterAvailable sinceJuly 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_PDHA2S291D
Plasmid#115193PurposeLentiviral transduction and expression of PDHA2S291D into any mammalian cellDepositorInsertPDHA2S291D (PDHA2 Human)
UseLentiviralTagsExpressionMutationp.S291DPromoterEF1alphaAvailable sinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_PDHA2S293D
Plasmid#115194PurposeLentiviral transduction and expression of PDHA2S293D into any mammalian cellDepositorInsertPDHA2S293D (PDHA2 Human)
UseLentiviralTagsExpressionMutationp.S293DPromoterEF1alphaAvailable sinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_PDHA2S291D/S293D
Plasmid#115195PurposeLentiviral transduction and expression of PDHA2S291D/S293D into any mammalian cellDepositorInsertPDHA2S291D/S293D (PDHA2 Human)
UseLentiviralTagsExpressionMutationp.S291D/S293DPromoterEF1alphaAvailable sinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pClgn1.1_Dcst2-3xHA
Plasmid#183541PurposeExpress Dcst2-3xHA under the mouse Clgn promoter.DepositorInsertDC-STAMP domain containing 2 (Dcst2 Mouse)
UseTagsHAExpressionMammalianMutationPromoterAvailable sinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmAGO2-RC_B
Plasmid#145981PurposeInsect Expression of DmAGO2-RCDepositorInsertDmAGO2-RC (AGO2 Fly)
UseTagsExpressionInsectMutationA deletion of AA 51-56 and an insertion of 23 AA …PromoterAvailable sinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
SYKA-c022
Plasmid#175490PurposeProtein expression in bacterial cells. Tandem SH2 domains, M6-N269. Can be biotinylated.DepositorInsertSYK (SYK Human)
UseTagsAviTag and His6-TEVExpressionBacterialMutationPromoterAvailable sinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
MSNA-c028
Plasmid#175470PurposeProtein expression in bacterial cells. FERM domain, M1-E346. Contains H288A point mutation that reduces binding to CD44.DepositorInsertMSN (MSN Human)
UseTagsHis6-TEVExpressionBacterialMutationH288APromoterAvailable sinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
MSNA-c021
Plasmid#175468PurposeProtein expression in bacterial cells. FERM domain, M1-E346. Contains L281R point mutation that reduces binding to CD44.DepositorInsertMSN (MSN Human)
UseTagsHis6-TEVExpressionBacterialMutationL281RPromoterAvailable sinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
MSNA-c001
Plasmid#175466PurposeProtein expression in bacterial cells. FERM domain, M1-E346. Used for crystallography (PDB:6TXQ).DepositorInsertMSN (MSN Human)
UseTagsHis6-TEVExpressionBacterialMutationPromoterAvailable sinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV(WT)-mouse-full-length-CHMP3-HA
Plasmid#154175Purposeexpresses mouse CHMP3 in mammalian cellsDepositorInsertCHMP3 (Chmp3 Mouse)
UseTagsHAExpressionMammalianMutationPromoterCMVAvailable sinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEF1α-mouse-CHMP3(147)-HA
Plasmid#154177Purposeexpresses mouse CHMP3(147) in mammalian cellsDepositorInsertCHMP3 (Chmp3 Mouse)
UseTagsHAExpressionMammalianMutationC-terminal truncation of CHMP3 at amino acid 147PromoterEF1alphaAvailable sinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1_GI.1_A37C-A44C
Plasmid#162582PurposeExpresses norovirus GI.1 VP1 protein with mutations A37C-A44C in Sf9 insect cellsDepositorInsertVP1 protein from human norovirus GI.1
UseTagsExpressionInsectMutationAlanine 37 changed to Cysteine and Alanine 44 cha…PromoterpolyhedringAvailable sinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1_GI.1_Q141V-P221L
Plasmid#162584PurposeExpresses norovirus GI.1 VP1 protein with mutations Q141V-P221L in Sf9 insect cellsDepositorInsertVP1 protein from human norovirus GI.1
UseTagsExpressionInsectMutationGlutamine 141 changed to Valine and Proline 221 c…PromoterpolyhedrinAvailable sinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1_GI.1_L144C-P221C
Plasmid#162585PurposeExpresses norovirus GI.1 VP1 protein with mutations L144C-P221C in Sf9 insect cellsDepositorInsertVP1 protein from human norovirus GI.1
UseTagsExpressionInsectMutationLeucine 144 changed to Cysteine and Proline 221 c…PromoterpolyhderinAvailable sinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1_GI.1_G131C-N172C
Plasmid#162586PurposeExpresses norovirus GI.1 VP1 protein with mutations G131C-N172C in Sf9 insect cellsDepositorInsertVP1 protein from human norovirus GI.1
UseTagsExpressionInsectMutationGlycine 131 changed to Cysteine and Asparagine 17…PromoterpolyhedrinAvailable sinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1_GI.1_N167C-L169C
Plasmid#162587PurposeExpresses norovirus GI.1 VP1 protein with mutations N167C-L169C in Sf9 insect cellsDepositorInsertVP1 protein from human norovirus GI.1
UseTagsExpressionInsectMutationAsparagine 167 changed to Cysteine and Leucine 16…PromoterpolyhedrinAvailable sinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only