We narrowed to 13,309 results for: sequence
-
Plasmid#72157PurposeExpresses the extracellular region of the Sema4D protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 29, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pMTB2-NLS-BirA-2A-mCherry_Ras
Plasmid#80067PurposeBeta-actin2 promoter driving HA-tagged biotin ligase (BirA) with NLS, a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA) with nuclear localization signal (NLS), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialPromoterBeta-actin2Available SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6P-1_WT RAD23A
Plasmid#201456PurposeExpresses human RAD23A with an N-terminal GST tag in E. coliDepositorInsertUV excision repair protein RAD23 homolog A (RAD23A Human)
TagsGSTExpressionBacterialMutationCoding sequence has been optimised for expression…Promotertac promoterAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
Sema6d.1-Fc-His
Plasmid#72168PurposeExpresses the extracellular region of the Sema6D, isoform 1 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HA-Flag-natT1R2 a22-end_I132S-S212N
Plasmid#113952Purposemammalian expression plasmid for FLAG-tagged human T1R2 with signal peptide of influenza hemagglutinin; expression-enhanced variantDepositorInsertT1R2 (TAS1R2 Human)
TagsFLAG and Signal/leader sequence from influenza he…ExpressionMammalianMutationdelete N-terminal 21 residues, I132S and S212N su…PromotercmvAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HA-Flag-natT1R2 a22-end_I132S-S212N-D231G
Plasmid#113953Purposemammalian expression plasmid for FLAG-tagged human T1R2 with signal peptide of influenza hemagglutinin; expression-enhanced variantDepositorInsertT1R2 (TAS1R2 Human)
TagsFLAG and Signal/leader sequence from influenza he…ExpressionMammalianMutationdelete N-terminal 21 residues, I132S, S212N, and …PromotercmvAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBacMam2-DiEx-LIC-C entry vector
Plasmid#111752PurposeIntermediate vector containing HTT gene, except for polyQ region. Used to clone various polyQ lengths into HTT sequence with C-term FLAG tag. Baculovirus transfer vector for insect and mammalian cellsDepositorTypeEmpty backboneUseBaculovirus expressionTagsFLAGExpressionMammalianAvailable SinceNov. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pAct-AtINTBxb1
Plasmid#127536PurposePlasmid encodes A. thaliana codon optimized Integrase Bxb1.DepositorInsertIntegrase Bxb1 coding sequence codon optimized for A. thaliana expression.
ExpressionPlantAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMC060-HisMS2_PLP_Env_pac
Plasmid#155040PurposeGeneration of MS2 Virus Like Particles packaged with the sequence for the SARS-CoV-2 Envelope GeneDepositorInsertsMaturation Protein
Coat Protein Dimer
Envelope Gene
ExpressionBacterialMutationRemove TypeIIs Restriction SitesPromoterT7Available SinceSept. 9, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits