We narrowed to 14,200 results for: cas9
-
Plasmid#126901PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable sinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ OBfold
Plasmid#126889PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable sinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ HDT701
Plasmid#126898PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable sinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ Dja6_1
Plasmid#126894PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable sinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ ERF922
Plasmid#126893PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable sinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
CMV-VPR-S-L1-dCjCas9 MiniCAFE
Plasmid#169910PurposeExpression of a truncated VPR-dCjCas9 fusion protein to activate gene expression.DepositorInsertMiniCAFE
UseCRISPRExpressionMammalianMutationD8A, HNH-truncation (Δ495–609 aa) in CjCas9PromoterCMVAvailable sinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Puro-P2A-EGFP-PJY392
Plasmid#251161PurposeCloning backbone for guide RNAs compatible with 10x FLEXDepositorInsertSpCas9 sgRNA F+E
UseCRISPR and LentiviralPromoterEF1aAvailable sinceJune 17, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CRISPRv2-sgNTC_#2-hygro
Plasmid#254677Purposeknockout non-targeting controlDepositorInsertsgRNA with Cas9 and hygromycin resistance
UseCRISPR and LentiviralAvailable sinceMay 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CRISPRv2-sgNTC_#1-hygro
Plasmid#254676Purposeknockout non-targeting controlDepositorInsertsgRNA with Cas9 and hygromycin resistance
UseCRISPR and LentiviralAvailable sinceMay 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
PX461 ABE8e SpCas9 ERN1 ex18 5'ss
Plasmid#250298PurposeVector for inducing 5' splice site mutation (base editing)DepositorInsertABE8e SpCas9
ExpressionMammalianAvailable sinceApril 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
hDNMT3B_KO_puro
Plasmid#234998PurposeStable knockout of DNMT3B function in mammalian cellsDepositorInserthCas9
UseCRISPR and LentiviralExpressionMammalianAvailable sinceJuly 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpCas9-NG-P2A-EGFP (RTW3677)
Plasmid#139994PurposeCMV and T7 promoter expression plasmid for human codon optimized SpCas9-NG(L1111R/D1135V/G1218R/E1219F/A1322R/R1335V/T1337R) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFPDepositorInserthuman codon optimized SpCas9-NG with BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationSpCas9-NG=L1111R/D1135V/G1218R/E1219F/A1322R/R133…PromoterCMV and T7Available sinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pENTR_Wheat_live_Cas9
Plasmid#126880PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and BpiI sites for sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable sinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAS9-mCherry empty
Plasmid#80975PurposeCas9, mCherry, and sgRNA expressionDepositorTypeEmpty backboneExpressionMammalianAvailable sinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pKRG3-mU6-PUb-hSpCas9-pAc
Plasmid#162163PurposeExpresses hSpCas9-T2A-pAc (Ae. aegypti PUb promoter) with cloning site for sgRNAs (Ae. aegypti U6 promoter); puromycin selectableDepositorInsertshSpCas9
sgRNA
UseCRISPRTagsT2A-pAcExpressionInsectPromoterAe. aegypti PUb and Ae. aegypti U6Available sinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCjeCas9
Plasmid#172215PurposeExpresses Campylobacter jejuni Cas9 (CjeCas9) in bacterial cellsDepositorInsertCas9 endonuclease from the Campylobacter jejuni Type II CRISPR/Cas system
TagsHistagPromoterT7Available sinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-SpCas9D10A nickase
Plasmid#216737PurposeExpresses SpCas9-D10A nickase from a CMVd1 promoter. For AAV packaging. Derived from pAAV-CMV-SpCas9 (Addgene #113034)DepositorPublicationInsertCas9-D10A nickase
UseAAV and CRISPRExpressionMammalianMutationD10APromoterCMVd1Available sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYLsgRNA-OsU6b
Plasmid#66196Purposecloning of sgRNAs for expression in plantsDepositorTypeEmpty backboneUseCloning vectorPromoterOsU6bAvailable sinceAug. 10, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AAV:ITR-U6-sgRNA(LacZ)-pCBh-Cre-WPRE-hGHpA-ITR
Plasmid#60228PurposeExpresses Cre recombinase from the Cbh promoter and one U6-driven sgRNA control targeting LacZ. AAV backbone.DepositorInsertssgRNA
Cre recombinase
UseAAV, CRISPR, Cre/Lox, and Mouse TargetingTagsCre-HAExpressionMammalianPromoterCBh and U6Available sinceNov. 3, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
p426_Cas9_gRNA-SAP155c
Plasmid#87390PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155c
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only