Skip to main content
Addgene
Showing: 1 - 40 of 208 results

  1. Quick Guide to Working with Drosophila Part 3: Genome Engineering in Flies

    Type
    Blog Post
    ... References 1. J. R. Bateman, et al. Site-Specific Transformation of Drosophila via PhiC31 Integrase-Mediated... you’d like to use to generate your new fly line: 1. Where would you like the gene to be incorporated ...control exactly in which locus your transgene ends up (1): Random insertion has the advantage that you can...earlier, even genes not found in Drosophila can be studied. Using a Drosophila cell line, I’ve studied a transcription...described the fundamentals of how to work with Drosophila as an experimental model organism. I then described...your flies will be ready for experimentation. Drosophila are amenable to many different kinds of experimental...can be employed to look at oxygen consumption. Drosophila are also used in cancer research (3). The sky...

  2. Quick Guide to Working with Drosophila Part 2: Controlling Gene Expression in Flies with Gal4/UAS

    Type
    Blog Post
    ... activation system co-opted from yeast (1). It is a Drosophila geneticist’s main workhorse to turn genes...Duffy, GAL4 System in Drosophila : A Fly Geneticist’s Swiss Army Knife, Genesis 34, 1–15 (2002).PubMed PMID...A Versatile Toolkit for Gene Expression in Drosophila, 3, 1–10 (2015). PubMed PMID: 21356876. 5. J. Chow...he still reads “#” as a “pound symbol”. References 1. A. H. Brand, N. Perrimon, Targeted gene expression...second post in our quick guide to working with Drosophila, you’ll learn how to maniupate expression of ...be overexpressed or knocked down. To do this, Drosophila geneticists use the Gal4/UAS system. This incredibly...had nearly a decade of experience working with Drosophila as an experimental system. Jon enjoys studying...

  3. Quick Guide to Working with Drosophila Part 1: Getting Started with Flies

    Type
    Blog Post
    ...Recombination in Drosophila Learn about Cre-Lox Resources on Addgene.org Find Drosophila Plamids Drosophila CRISPR... ortholog in the Drosophila genome? Continue reading and I’ll show you how Drosophila can be used to push...favorite gene (YFG) in Drosophila (and even if there’s not!) the wealth of Drosophila genetic tools available..., and overexpress YFG in a Drosophila cell line. Knock downs in Drosophila cell lines are extremely effective...your research in new and exciting directions. Drosophila are very easy to manipulate genetically and have... second post will detail a major tool used by Drosophila geneticists (the Gal4/UAS system), and the third... how you can make your own mutant flies. Find Drosophila Resources at Addgene The birds and the bees ...

  4. CRISPR Plasmids - Drosophila

    Type
    Collection
    ...Bullock and Port 49411 pCFD4-U6:1_U6:3tandemgRNAs dU6:1 and dU6:3 BbsI Injection or in vitro transcription...O'Connor-Giles, Harrison, Wildonger 49408 pCFD1-dU6:1gRNA dU6:1 BbsI Injection or in vitro transcription Virmilion... CRISPR Drosophila CRISPR Plasmids: Drosophila Browse CRISPR...designed for use in Drosophila and other insects. CRISPR...gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR...CRISPR plasmids have been designed for use in Drosophila and other insects. Cut Fully functional CRISPR...

  5. Immunology Research Plasmids and Resources

    Type
    Collection
    ...IGHDY1 IGHD1-1 immunoglobulin heavy diversity 1-1 IGHD11 IGHD1-14 immunoglobulin heavy diversity 1-14 (non-...IGHV6-1 immunoglobulin heavy variable 6-1 IGHV61, VH IGHV7-4-1 immunoglobulin heavy variable 7-4-1 IGHV7...defensin, alpha 1 DEF1, DEFA2, HNP-1, HP-1, MGC138393, MRS DEFA3 defensin, alpha 3, neutrophil-specific DEF3... TAPBP-R, TAPBPR THBS1 thrombospondin 1 THBS, THBS-1, TSP, TSP-1, TSP1 TRPC4AP transient receptor potential...variable 2-8 IGLV28, V1-2 IGLV3-1 immunoglobulin lambda variable 3-1 IGLV31, V2-1 IGLV3-10 immunoglobulin lambda...NCC-1, NCC1, SCYA13, SCYL1 CCL14 chemokine (C-C motif) ligand 14 CC-1, CC-3, CKb1, FLJ16015, HCC-1, HCC...

  6. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...Function PI AV-1-49531P 100040-AAV1 pAAV.hSyn1.Twitch2B.WPRE.SV40 Biosensor Oliver Griesbeck AV-1-50942 50942...Tobias Rose AV-1-PV2723 98929-AAV1 pAAV.hSyn.iGluSnFr.WPRE.SV40 Biosensor Loren Looger AV-1-PV2724 98931... Looger AV-1-PV2725 98932-AAV1 pAAV.CAG.Flex.iGluSnFr.WPRE.SV40 Biosensor Loren Looger AV-1-PV2816 100835... Kim AV-1-PV2817 100839-AAV1 pAAV.CAG.Flex.GCaMP6m.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1-PV2818 ... Kim AV-1-PV2819 100833-AAV1 pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1-PV2820 ... Kim AV-1-PV2821 100845-AAV1 pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1-PV2822 ...Douglas Kim AV-1-PV2823 100841-AAV1 pAAV.Syn.GCaMP6m.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1-PV2824 100843...

  7. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ... Human Doench 3rd 1, 2, or 4 49,766 arrays Broad GPP kinome Brunello 75314, 75315 (1 plasmid) 75312, 75313...Version 1 1000000069 Knockout Human Moffat 3rd 12 176,500 Toronto KnockOut - Version 3 90294 (1 plasmid...Libraries 153101-153106 Knockout Yeast Borodina N/A 1 Varies Bovine CRISPR Knockout Libraries 213927, 213928...pgRNAs 1,718 Broad GPP genome-wide Brunello 73179 (1 plasmid) 73178 (2 plasmid) Knockout Human Doench and...Root 3rd 4 76,441 Broad GPP genome-wide Brie 73632 (1 plasmid) 73633 (2 plasmid) Knockout Mouse Doench and...and Root 3rd 4 3,052 Broad GPP kinome Brie 75317 (1 plasmid) 75316 (2 plasmid) Knockout Mouse Doench and...Human Birsoy 3rd 8 20,051 Human GeCKO v2 1000000048 (1 plasmid) 1000000049 (2 plasmid) Knockout Human Zhang...

  8. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Fawzi 127194 RP1B FUS 1-163 QQ4xSS #1 FUS His T7 ALS Nicolas Fawzi 127195 RP1B FUS 1-163 QQ4xSS #2 FUS His... type 1 scFv [L24/1] ITPR1 CMV Spinocerebellar ataxia James Trimmer 206790 IP3 receptor, type 1 scFv [...Cookson 13321 pGEX5X.1 PINK1 WT PINK1 GST tac Parkinson's Mark Cookson 13322 pGEX5X.1 PINK1 KD PINK1 GST... His, V5 EF-1 alpha Parkinson's Mark Cookson 25081 pDEST51-LRRK2-R1441C LRRK2 His, V5 EF-1 alpha Parkinson's... His, V5 EF-1 alpha Parkinson's Mark Cookson 25083 pDEST51-LRRK2-R1441H LRRK2 His, V5 EF-1 alpha Parkinson's...Cookson 29350 pGEX-5X-1-DJ1-WT PARK7 GST tac Parkinson's Mark Cookson 29351 pGEX-5X-1-DJ1-D149A PARK7 GST...Cookson 29352 pGEX-5X-1-DJ1-E64D PARK7 GST tac Parkinson's Mark Cookson 29353 pGEX-5X-1-DJ1-M26I PARK7 GST...

  9. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...Brown 11908 pEGFP-N1 alpha-actinin 1 Actin Filaments alpha-actinin 1 EGFP Carol Otey 27676 Cortactin-pmCherryC1...Huttenlocher 11908 pEGFP-N1 alpha-actinin 1 Focal Adhesions alpha-actinin 1 EGFP Carol Otey 31923 pPaxillin-PSmOrange...Autophagosome Sequestosome-1 EGFP Noboru Mizushima 38272 pMXs-IP GFP-WIPI-1 Autophagosome WIPI1 EGFP Noboru...apparatus eNOS(1-33) CFP Alexandra Newton 36205 pmTurquoise2-Golgi Golgi apparatus B4GALT1(1-61) mTurquoise2...Filaments Utrophin (aa# 1-261) GFP William Bement 26740 mCherry-UtrCH Actin Filaments Utrophin mCherry ... Shirihai 158003 pCMV-mGold-CAF1-C-10 Nucleus CAF-1 mGold Francois St-Pierre 27705 CAV1-mCherry Caveolae...COXIV-COX8-dL5-2XG4S-mCer3 Mitochondria COX IV-derived (1-22 aa) import sequence and COX VIII signal peptide...

  10. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...190293 Anti-AMIGO-1 [L86/14] AMIGO-1 Mouse Mouse IgG2a 190294 Anti-AMIGO-1 [L86/2] AMIGO-1 Mouse Mouse IgG2a...ATPase 1 [L60/4R-2b] Copper ATPase 1 Human Mouse IgG2b 206648 Anti-AMIGO-1 [L86/33R-2b] AMIGO-1 Mouse ...channel [L6/60R-1] Slo1 K+ channel Mouse Mouse IgG1 206695 Anti-AMIGO-1 [L86/33R-1] AMIGO-1 Mouse Mouse IgG2a...Anti-Olig1 [N149/25R-1] Olig1 Mouse Mouse IgG1 206702 Anti-Neurexin-1-Beta [N170A/1R-1] Neurexin-1-Beta Human Mouse...222160 Beclin-1 [N248A/15R] Beclin-1 Mouse Mouse IgG2a 222161 Beclin-1 [N248A/22R] Beclin-1 Mouse Mouse ...Mouse Mouse 190534 Neurexin-1-Beta scFv [N170A/1] N170A/1 scFv Neurexin-1-Beta Human Mouse 190535 PSD-...Mouse 206755 IP3 receptor, type 1 scFv [L24/1] L24/1 scFv IP3 receptor, type 1 Rat Mouse 206756 VSP scFv [...

  11. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...AdEasier®-1 cells (strain) - Bacterial strain that contains AdEasy®-1 plasmid... expression Puromycin Mammalian pLKO.1 - TRC cloning vector - Lentiviral... Tet-inducible lentiviral shRNA expression pMKO.1 puro - Retroviral shRNA expression ... expression Hygromycin Mammalian pLKO.1 hygro - Lentiviral shRNA expression... - Retroviral gene expression pMKO.1 GFP - Retroviral shRNA expression pSico... expression, multiple selectable markers pMKO.1 puro - Mammalian retroviral shRNA expression...under your chosen promoter pAdEasy®-1 - Recombine plasmids from the shuttle...

  12. Cre-lox system

    Type
    Collection
    ...Cre-GFP fusion EF-1 alpha Mammalian Sauer 11923 pBS598 EF1alpha-EGFPcre Cre-EGFP fusion EF-1 alpha Mammalian...mCherry coexpression EF-1 alpha AAV Deisseroth 55635 pAAV-EF1a-sCre SCre EF-1 alpha AAV Deisseroth 55636...55636 pAAV-EF1a-Cre Cre EF-1 alpha AAV Deisseroth 55638 pAAV-EF1a-vCre VCre EF-1 alpha AAV Deisseroth 59701...) EF-1 alpha AAV Cepko 69571 pAAV-EF1a-C-CreintG Cre recombinase dependent on GFP (CRE-DOG) EF-1 alpha... Mammalian Sauer 11918 pBS513 EF1alpha-cre Cre EF-1 alpha Mammalian Sauer 11919 pBS448 RSV-GFPcre Cre-...11955 pBS505 EF1alpha-EGFPcre* Cre-EGFP fusion EF-1 alpha Mammalian Sauer 11956 pBS594 promoterless EGFPcre...GFAP-Cre Cre GFAP Mammalian Sofroniew 25997 LV-Cre pLKO.1 Cre and shRNA coexpression CMV Lentiviral Fuchs 26646...

  13. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...accumulation in bacteria. Biotechnol Biofuels. 2008 Jun 3. 1(1):11. Wolf Frommer Maltose Green fluorescent MBP-based...signalling mechanism. Nat Commun. 2017 Jun 29;8(1):49. Philip Mullineaux Insulin Sensor for Imaging Insulin...of cellular physiology. Nat Commun. 2020 Aug 4;11(1):3881. Adam Cohen Calcium GCaMP6f expression in forebrain...Dynamics in High-Ca Organelles. Cell Chem Biol. 2016 Jun 1. pii: S2451-9456(16)30163-5. Teresa Alonso , Javier... intracellular calcium. Nat Commun. 2021 Dec 9;12(1):7159. Dorus Gadella Calcium Teal genetically encoded...Neurophotonics. 2024 Apr;11(2):024207. doi: 10.1117/1.NPh.11.2.024207. Robert Campbell Calcium Ratiometric...orange-emitting fluorescent proteins. Nat Commun. 2017 Sep 5;8(1):431. Wolf Frommer Calcium Red-, yellow-, or cyan-...

  14. Allen Institute for Cell Science Plasmid Collection

    Type
    Collection
    ...Institute ID Tag Protein Structure 87420 PXN-EGFP AICSDP-1 EGFP Paxillin Matrix Adhesions 87421 TUBA1B-mEGFP ...TJP1-mEGFP AICSDP-23 mEGFP Tight junction protein ZO-1 Tight junctions 91565 AAVS1-mEGFP AICSDP-35 mEGFP ...Centrioles 101782 LAMP1-mEGFP AICSDP-19 mEGFP LAMP-1 Lysosome 101783 MAP1LC3B-mEGFP AICSDP-25 mEGFP Autophagy-related...101786 ST6GAL1-mEGFP AICSDP-26 mEGFP Sialyltransferase 1 Golgi 109122 NPM1-mEGFP AICSDP-50 mEGFP Nucleophosmin... HIST1H2BJ-mEGFP AICSDP-52 mEGFP Histone H2B type 1-J Histones 109119 CTNNB1-mEGFP AICSDP-47 mEGFP Beta-catenin...Nuclear speckles 159744 DMD-mEGFP AICSDP-55 mEGFP Dystrophin Costameres 159745 TFAM-mEGFP AICSDP-72 mEGFP ...

  15. Validated gRNA Sequences

    Type
    Collection
    ...Mendenhall rde-1(D718) C. elegans TGCCATTAACTATGTATGT 59927 cut S. pyogenes 25161212 Fire rde-1(D801) C. elegans...24346702 Wolfe sqt-1 C. elegans GGAAGGACATAGTTGTCAT 59935 cut S. pyogenes 25161212 Fire sqt-1 C. elegans TGTGGAGTTGGGGTAGCGT...AMPK alpha 1 H. sapiens GGCTGTCGCCATCTTTCTCC 74374 nick S. pyogenes 26816379 Shaw AMPK alpha 1 H. sapiens...GCCACAAATCAGATTAATTTGGG 64939 tag S. pyogenes 26355004 Mendenhall csr-1 N. crassa GAGTGGGAGGGTCCCGTCCT 68060 cut S. pyogenes...GCATGGGTGATGTCAATGCC 69238 cut S. pyogenes 26480473 Wolfe Kit-1 R. norvegicus CATCTGTGCGGCCGTTGGCT 60969 cut S. pyogenes...TTGATCCAAATTATAACCCG 68896 interfere S. pyogenes 26918244 Lu NDM-1 GGGCAGTCGCTTCCAACGGTTTGATCGTCA 61270 cut S. pyogenes... 60719 activate S. pyogenes 25664691 Gersbach pha-1 C. elegans ATGAATAACTTGATGAACAT 61252 cut S. pyogenes...

  16. CRISPR Plasmids - Cascade-Cas3

    Type
    Collection
    ...endogenous repair mechanisms. Cas3 belongs to the Class 1 family of CRISPR systems, the most abundant type found...bacteria and archaea. While abundant in nature, Class 1 systems are largely underutilized compared to their...still separate the individual Cas components. Figure 1: Overview of Cascade-Cas3 mechanism. Created with ...gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR...

  17. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...3tandemgRNAs Drosophila Single plasmid for the expression of two gRNAs from Drosophila U6:1 and U6:3 promoters...Lentiviral BsmBI yes, cut S. pyogenes EGFP Ebert pLKO.1-puro U6 sgRNA BfuAI stuffer 50920 Mammalian/Lentiviral...Worm HindIII none S. pyogenes de Bono sgRNA with rpr-1 promoter 48961 Worm EcoRI none S. pyogenes de Bono...Zebrafish BseRI none S. pyogenes Zon pCRISPomyces-1 61736 Bacteria BbsI yes, cut S. pyogenes Apramycin...see plasmid page yes, cut S. pyogenes BFP Kuhn pLKO.1-puro U6 sgRNA BfuAI large stuffer 52628 Mammalian/...Puro Zoldos pX330-U6-Chimeric_BB-CBh-hSpCas9-hGem(1/110) 71707 Mammalian hU6 yes, cut S. pyogenes Draetta...expression of Cas9, dCas9, or dCas9-VP64 along with 1-4 sgRNAs expressed from independent promoters. sgRNAs...

  18. Lentivirus Plasmids

    Type
    Collection
    ...working with lentivirus: these viruses are based on HIV-1, which may require additional lab biosafety procedures...". ID Plasmid Generation Description PI 8453 pLKO.1 puro 3rd U6-driven shRNA empty plasmid with puro resistance...plasmid 24150 for hygro resistance. Weinberg 10878 pLKO.1 – TRC cloning plasmid 3rd U6-driven shRNA empty plasmid... EGFP coexpression. Trono 17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression...article for more similar plasmids. Elledge 21373 pHIV-EGFP 3rd EF-1alpha driven expression of cDNA and...

  19. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ... cleaves it to destroy the invader ( Figure 1 ). Figure 1: An overview of the endogenous Type II bacterial...separated by short palindromic repeat sequences. (1) The CRISPR array is transcribed to make the pre-CRISPR...engineering, with Type V following in 2015. Class 1 (Multi-subunit effector complex) Class 2 (Single multi-domain...enChIP) using CRISPR. Biochem Biophys Res Commun . 439(1):132-6. PMID: 23942116 Gilbert LA, Horlbeck MA, Adamson...CRISPR-Cpf1 using a single crRNA array. Nat Biotechnol . 35(1):31-34. PMID: 27918548... , Streptococcus , Streptomyces , and others) Drosophila Plants (monocots and dicots) C. elegans Yeast...

  20. Genetic Code Expansion

    Type
    Collection
    ...Bacterial TAG Farren Isaacs 73545 pEvol-pAcFRS.1.t1 pAcFRS.1.t1 E. coli p-acetyl-l-phenylalanine (pAcF) Bacterial...Bacterial TAG Farren Isaacs 73547 pEvol-pAzFRS.1.t1 pAzFRS.1.t1 E. coli p-azido-l-phenylalanine (pAzF) Bacterial...7FTrp) Bacterial TAG Thomas Huber 207639 pEVOL-NBK-1 PylRS M. mazei Pyrrolysine Bacterial Cole DeForest...and tyrU gene replaced by GentR) and release factor 1. Expresses archaeal MjTyrRS/tRNA pair instead. For...Huber 164080 pCMV-MtPylRS (human-opti) PylRS M. thermophila acetyl-lysine Mammalian Tao Liu 164081 pCMV-MfPylRS...Liu 164195 pCMV-MtAcKRS (human-opti) AcKRS M. thermophila acetyl-lysine Mammalian Tao Liu 164196 pCMV-MfBulKRS...

  21. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...581 95 4.7 1 hr Tandem-dimer pCSCMV:tdTomato - Mammalian Expression pFA6a-link-tdTomato-SpHis5 - Yeast Expression...Expression mEGFP 488 507 34 6 Monomer (A206K) pmEGFP-1 - Mammalian Expression mEGFP-N1 - Mammalian Expression...-pBAD - Bacterial Expression mRFP1 584 607 13 4.5 1 hr Monomer pcDNA3-mRFP - Mammalian Expression pMXs-mRFP1... of Biomedical Optics, Feburary 2005, Vol. 10 No. 1, p. 14003 Chu et al. : Nature Methods, May 2014 Vol...Expression mT-sapphire 399 511 Monomer (A206K) mT-Sapphire-N1 - Mammalian Expression mT-Sapphire-C1 - Mammalian...Structure Plasmids T-sapphire 399 511 26 4.9 1.3 hr Prone to dimerization pFA6a-link-yETSapphire-CaUra3 - Yeast...cysteine-free SGFP2) ZsGreen 493 505 39 Tetramer pHIV-Zsgreen - Mammalian Expression (this is a bicistronic...

  22. CRISPR Guide

    Type
    Collection
    ... most popular genome engineering approach. Figure 1: Overview of the basic CRISPR mechanism Engineered...from Staphylococcus aureus ) has a coding sequence ~1 kb shorter than SpCas9 while retaining the same basic...lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9 is included in the gRNA-containing...efficiency and fidelity. Nature Communications , 13 (1), 1425. PMID: 35301321 Edraki, A., Mir, A., Ibraheim...interrogation by SpRY-Cas9. Nature Communications , 15 (1), 3663. PMID: 38688943 Hsu, P. D., Scott, D. A., Weinstein...increase its specificity. Nature Communications , 9 (1). PMID: 30082838 Maddalo, D., Manchado, E., Concepcion...CRISPR-Cas9 with Bacteriophage Proteins. Cell , 168 (1–2), 150-158.e10. PMID: 28041849 Sakuma, T., Nishikawa...

  23. CRISPR Plasmids - Double-Strand Break (Cut)

    Type
    Collection
    ...researchers use ssDNA or dsDNA repair templates with 1. homology to the DNA flanking the DSB and 2. a specific...gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR...for expression in mammalian systems, bacteria, Drosophila, plants, C. elegans, yeast, zebrafish, and Xenopus...ID Plasmid Gene/Insert Promoter PI Publication Drosophila ID Plasmid Gene/Insert Promoter Selectable Marker...

  24. CRISPR Plasmids - CRISPR Transposases (CAST)

    Type
    Collection
    ...some mammalian systems have been developed. Figure 1: Overview of the basic CAST mechanism. Created with...gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR...

  25. Botman-Teusink Yeast FP Collection

    Type
    Collection
    ...proteins in budding yeast. Sci Rep. 2019 Feb 19;9(1):2234. doi: 10.1038/s41598-019-38913-z. PubMed 30783202...Lee et al., 2013), and are available with URA3, SpHIS5 and KANMX markers. The FP together with the protothropic...

  26. CRISPR Plasmids - Prime Edit

    Type
    Collection
    ...available as a substrate for another round. Figure 1: Overview of prime editing. Created with BioRender.com...OsU3 pegRNA No Yiping Qi 149545 pCFD3-NS Drosophila Drosophila U6:3 pegRNA BbsI No Vermilion Norbert Perrimon...Perrimon 149546 pCFD5-NS Drosophila Drosophila U6:3 pegRNA + nicking sgRNA BbsI No Vermilion Norbert Perrimon...gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR...expression in mammalian systems, bacteria, plants, and Drosophila. Mammalian ID Plasmid Gene/Insert Promoter Selectable...Insert Promoter Selectable Marker PI Publication Drosophila ID Plasmid Gene/Insert Promoter Selectable Marker...

  27. Great Results Start with Great Standard Curves

    Type
    Blog Post
    ...    Figure 1: A 1 mg/mL control is diluted in a series ranging from 1:2 to 1:32. Each individual...example, Figure 1 depicts a 2-fold dilution series. Each step of the series dilutes by 1:2 for a series...series that ranges from 1:2–1:32. The specific dilution series used will depend on the expected concentration... points fit the trendline. R2 ranges from 0 to 1 with 1 being a perfect fit and 0 indicating that there...individual step of the series is consistent at 1:2. When preparing a dilution series, use a new pipette tip for...absorbance is plotted on the y-axis. With the help of graphing software, you then generate a trendline for the...the quality of a standard curve scientists use graphing software to calculate the data’s coefficient of...

  28. Some Like it Hot: Thermostable GeoCas9

    Type
    Blog Post
    ...Cells? Yes Yes Longevity in Serum?* No Yes Table 1. Comparing SpCas9 and GeoCas9. *For in vitro Cas9 ...GeoCas9 is active at high temperatures Figure 1: Thermostability of SpCas9 vs GeoCas9. SpCas9 or GeoCas9...from 25-80 °C. Activity is expressed as Kcleave (min-1). SpCas9 has maximum activity from 35-45 °C, while...outperformed SpCas9 at high temperatures. See Figure 1 for a summary of the experimental results. GeoCas9...from the thermophilic bacteria Geobacillus stearothermophilus (GeoCas9). G. stearothermophilus grows at...cells, yeast, drosophila, plants, worms, zebrafish, frogs, some bacteria; but not thermophilic (high heat...for facultative thermophiles (high OR medium heat loving), but not obligate thermophiles. However, the ...

  29. Treating Muscular Dystrophy with CRISPR Gene Editing

    Type
    Blog Post
    ...approximately 1 in 5000 males. DMD is caused primarily by frameshift mutations in dystrophin, a protein ... applicable to 80% of DMD patients. Figure 1: Exon skipping strategies for Duchenne muscular dystrophy...needed. First, CRISPR delivery must be optimized to: 1. Reach a high percentage of muscle cells throughout...also be closer than we might expect.   References 1. Kaiser J. CRISPR helps heal mice with muscular dystrophy...neurogenetic diseases. Nucleic Acid Ther. 2014 Feb;24(1):69-86. PubMed PMID: 24506781. PubMed Central PMCID...);186-91. doi: 10.1038/nature14299. Epub 2015 Apr 1. PubMed PMID: 25830891. PubMed Central PMCID: PMC4393360...for proper muscle function. Without functioning dystrophin, an individual experiences progressive muscle...

  30. Making CRISPR Plasmids Using Fragmid

    Type
    Blog Post
    ...building it! Table 1 has a list of Fragmid destination vectors currently available. Table 1: Fragmid destination...components on the Fragmid website.   Figure 1: (Top) Schematic overview and timeline of the Golden... CRISPR vector the Fragmid way!    Figure 1: Selecting your vector type on the Fragmid website...components available will depend on your answers in step 1, so you’ll only be able to select components that ...attR sequences for genome integration by phiC31) Drosophilia Plasmid pRDB_052 (for stable fly cell... pRDA_791 (contains only orio and ampR) Drosophilia Plasmid pRDB_051 (for stable fly cell lines...integration by spontaneous insertion)   Drosophilia Plasmid pRDB_053 (for transgenic flies; gypsy...

  31. Plasmids 101: Broad Host Range Plasmids

    Type
    Blog Post
    ...Table 1 has a detailed list of the bacterial species these plasmids are compatible with.  Table 1: Non-...reduced metabolic load (Meyer 2009). Figure 1: Idealized examples of a narrow host range plasmid...for DNA cloning in Gram-negative bacteria. Gene, 70(1), 191–197. https://doi.org/10.1016/0378-1119(88)90117... N.J.), 765, 327–343. https://doi.org/10.1007/978-1-61779-197-0_19  Meyer, R. (2009). Replication and ...Gluconacetobacter xylinus, Haemophilus influenzae, Hypomycrobium X, Legionella pneumophila, Methylophilus methyltrophus...Escherichia coli, Klebsiella spp., Legionella pneumophila, Methylophilus methylotrophus, Myxococcus virescens,... A. viscosus, Aerobacter aerogenes, Aeromonas hydrophila, Agrobacterium tumefaciens, Alcaligenes eutrophus...

  32. Caltech Systemic Capsids

    Type
    Collection
    ... Caltech and can help guide your decision. Figure 1: Decision tree for choosing your AAV capsid. Your ...tdTomato Control Boyden 83900 pAAV-mDlx-GFP-Fishell-1 Dlx GFP Control Fishell 99130 pAAV-mDlx-NLS-mRuby2...for the AAV Decision Tree The AAV decision tree graphic above helps you choose the best capsid for your...

  33. Typing CRISPR Systems

    Type
    Blog Post
    ...   Class 1 versus class 2 There are two CRISPR classes: Class 1 and Class 2. Class 1 CRISPR systems...archaea, though Class 1 remains largely underutilized compared to Class 2. Class 1 Despite their incredible...optimal plasmids to harness the power of Class 1 systems. Class 1 CRISPR systems can be further broken down...types, 33 subtypes, and 17 variants. Figure 1: Overview of the CRISPR classification hierarchy. ...effector complex after binding to a target. Class 1 is the most abundant of the two, comprising about ...incredible abundance, Class 1 CRISPR systems are less popular in the lab. This can be attributed to the multi-Cas...Type I CRISPR systems make up the majority of Class 1, and are the most common type of CRISPR overall. Type...

  34. Addgene Depositors Get More Citations

    Type
    Blog Post
    ...of publication. Table 1 provides an example calculation of the weights. Table 1: Journal Weighting Example...amassed nearly 2,400 citations in its first four years (1). In addition to publishing in Science, Professor ...papers without plasmids deposited with Addgene (Figure 1). Even aggregated this much, you can see the 2013...(F) Weight (=F/E) (G) Weighted Citations (=C*G) 1 2010 3 Nature  3.3% 10.5%   3.2  9.6 2 2010...website at: http://www.neil-t.com/ .   References 1. Cong, Le, et al. "Multiplex genome engineering using...highly cited, we went to one of the largest bibliographic databases available, Web of Science. For each... publication, Web of Science provides basic bibliographic information and uses its vast network of articles...

  35. Evolution of Brainbow: Using Cre-lox for Multicolor Labeling of Neurons

    Type
    Blog Post
    ...BD, Clevers H. Cell. 2010 Oct 1;143(1):134-44. PubMed. Drosophila Brainbow: a recombinase-based fluorescence...the Brainbow mouse neural labeling system. Brainbow-1 and -2 have been further refined to create Brainbow...subsequent recombinations cannot occur. While the Brainbow-1 system employs Cre-mediated deletion, the design of...antibodies specific to each fluorophore. Third, Brainbow-1 and Brainbow-2 each contained a “default” state; for...dendritic processes not previously visible with Brainbow-1 and -2. The general structure of Brainbow-1.0 is retained...study model organisms such as Drosophila and zebrafish. Brainbow in Drosophila has aided in the mapping of...tracing in other systems, such as zebrafish and Drosophila. Why Brainbow? Brainbow highlights the trend ...

  36. Optogenetics + CRISPR, Using Light to Control Genome Editing

    Type
    Blog Post
    ...2 (CRY2) and calcium and integrin-binding protein 1 (CIB1) proteins. The goal of both groups was to create... the Sata lab is composed of two fusion proteins: 1) the genomic anchor - an inactive, dead Cas9 protein...combination. The optimized LACE system consisted of: 1) CIBN-dCas9-CIBN, where CIBN is the N-terminal fragment.... crassa) (Kawano et al., 2015). Nicknamed paCas9-1 and consisting of the fusion proteins N713-pMag and...fold-induction of Cas9 activity (16.4-fold). This paCas9-1 light-inducible system was able to recognize the same...flCas9). When triggered by blue light (470nm), paCas9-1 induced indel mutations via NHEJ (frequency of 20.5%...background activity of the system by modifying paCas9-1 using nMagC714 instead of nMagHigh1-C714, generating...

  37. Technique: Probe Phage Genomes for Host Binding Proteins

    Type
    Blog Post
    ...which is also gaining a lot of new traction lately (1, 2), depends on knowledge of the structure(s) a given...RBPs successfully identified using this method. Step 1: Prepare a random fragment library of phage DNA This...first step involves digesting phage genomic DNA into 1-3 kb (approximately gene-sized) fragments so that ...in the bulk of resultant fragments falling between 1 and 3 kb results in optimal likelihood of capturing...solution-soaked filter paper (colony-side up) and leave for 1 h at room temperature. After this, it is helpful to...proteins expressed by your library. After blocking for 1 h at room temperature with gentle shaking, gently ... to incubate the membranes overnight in 500 mM to 1 M NaCl in order to enhance folding of the recombinant...

  38. Fluorescent Tagging of Endogenous Genes with SapTrap

    Type
    Blog Post
    ... 5’ and 3’ homology arm repair template (Fig. 1, Step 1). There is no need for PCR or cloning, as digestion...selectable marker, and connector to be released (Fig. 1, Step 2-3). Since donor plasmids of the same type ...correctly assembles the final targeting vector (Fig. 1, Step 4), and co-injection of the targeting vector...human cells. To use CRISPaint, users need 3 vectors:  1) a gRNA vector that targets the gene of interest, ... Tagging with Short Homology Donors.” Cell Rep.15(1) (2016):210-8. PubMed PMID: 27052166. Kunzelmann,.... They can also be introduced directly into a Drosophila S2 cell line stably expressing Cas9. This PCR...Comprehensive Toolbox for Genome Editing in Cultured Drosophila melanogaster Cells.” G3 (Bethesda) 6(6) (2016...

  39. Getting to Know Expansion Microscopy

    Type
    Blog Post
    ...protocols. A typical ExM protocol (Fig. 1) follows this structure: Step 1: fix (and maybe label) your sample...microscopy. Nat Biotechnol 1–12. https://doi.org/10.1038/s41587-022-01546-1  Mikhaylova M, Cloin BMC, ...just adding water.)  Step 5: Image   Figure 1: The ExM process allows you to physically magnify ...16:71–74. https://doi.org/10.1038/s41592-018-0238-1  Klimas A, Gallagher BR, Wijesekara P, et al (2023...microscopy: a brief history and new avenues. Philosophical Transactions Royal Soc 380:20210110. https:/...

  40. Plasmids 101: Repressible Promoters

    Type
    Blog Post
    ...gene expression and clonal analysis in Drosophila.” Nat Methods 9(1) (2011): 47-55. PubMed PMID: 22205518...Expression System for Drosophila. Methods Mol Biol. 2016;1478:53-78. doi: 10.1007/978-1-4939-6371-3_3. PMID...Bacillus. Appl Microbiol Biotechnol. 2019 Jan;103(1):303-313. doi: 10.1007/s00253-018-9485-4. Epub 2018... and lac promoters.” Proc Natl Acad Sci U S A. 80(1) (1983): 21-5. PubMed PMID: 6337371. PubMed Central...implemented in a variety of other organisms, such as sphingomonads and bacillus.  ADH1 The ADH1 negative repressible...culture. Repressible Binary Systems GAL4/UAS In Drosophila or development studies, you may hear some transcription... GAL80 under different promoters and create sophisticated patterns of UAS-driven gene expression. To further...
Showing: 1 - 40 of 208 results