We narrowed to 303 results for: hal.2
-
TypeBlog Post...Halloween is only 2 days away and here at Addgene we couldn’t be more excited! As a small, tight-knit...things: fun, teamwork, and competition. And our Halloween celebration this Friday will combine all of these...these. Addgenies have been organizing Halloween festivities for years – searching our photo archives I...destroyed to protect the innocent revelers. Our Halloween costume contests have become an annual tradition...colleagues. Success is sweet – as sweet as all that Halloween candy you’ll gorge yourself on in the coming days...Hopefully, I’ve made clear how excited we get for Halloween and how seriously we take costume design. In case...continue to have an amazing turnout for the annual Halloween costume, so I expect some great costumes this ...
-
Six Spooky Science Stories and Halloween at Addgene
TypeBlog Post...melanogaster." Molecular and cellular endocrinology 215.1-2 (2004): 1-10. PubMed PMID: 15026169. Soo, Rochelle...another snail, completing its lifecycle. Halloween genes The Halloween genes are a set of cytochrome P450 genes...incorporate science themes into our fun activities and Halloween is no exception. For the past 10+ years, Addgenies...ping pong table. This year, in addition to the Halloween contest, we’ve also carved pumpkins (yes, Blugene...melanogaster (Gilbert, 2004). Mutations in these genes are lethal, associated with defective exoskeleton formations...1983.3 (1983): 813-816. Gilbert, Lawrence I. "Halloween genes encode P450 enzymes that mediate steroid...company culture at Addgene See some of our previous Halloween costume contests ... -
"Hall of Fame" AAV Enhancers from the Allen Institute for Brain Science
TypeBlog Post...module_attribute "schema_version" is_json="true" %}{% raw %}2{% endraw %}{% end_module_attribute %}{% module_attribute...stereotaxically, STX) to the brain. Figure 2: Selection, prep, and testing of AAV enhancers in ... -
3 Challenges in Plant Synthetic Biology
TypeBlog Post...inspire and open a new conversation about GMOs. Challenge #2: Technical obstacles to plant synthetic biology...ve had to navigate the challenges involved in plant synthetic biology. Challenge #1: Public perception ...facilitates plant science. Challenge #3: Intellectual property There is another challenge associated with molecular... of well-characterized genetic tools make it challenging to engineer a specific function in these multicellular...fibers. And because working with plants can be challenging, there are a lot of unexplored areas in plant...manner. At Revolution Bio, we are addressing this challenge directly by developing a plant biotechnology product... a product without the use of these parts is challenging, and it’s made even more difficult by the fact... -
The Challenges of Cell Culture
TypeBlog Post...Henrietta Lacks. New York: Crown Publishers, 2010. 2. Gold, Michael. "A conspiracy of cells." State University... -
Fluorescent Protein Guide: Biosensors
TypeCollection...of basal H 2 O 2 levels with peroxiredoxin-based probes Real-time monitoring of basal H 2 O 2 levels with...Belousov Hydrogen Peroxide (H 2 O 2 ) Cytosolic or mitochondrial sensor for H 2 O 2 oxidation (roGFP2-Orp1) ...peroxiredoxin-2-based probe. Nat Commun. 2018 Aug 7;9(1):3145. Hadley Sikes Hydrogen Peroxide (H 2 O 2 ) Monitoring...encoded Ca(2+) indicator with enhanced two-photon absorption. Neurophotonics. 2024 Apr;11(2):024207. doi...Fast red fluorescent calcium sensors (fRCaMP1/2, fRGECO1/2) The kinetic mechanisms of fast-decay red-fluorescent...intracellular Zn(2+) homeostasis. Nat Methods. 2009 Oct;6(10):737-40. Maarten Merkx Zinc eZinCh-2 Zn2+ FRET ... eZinCh-2: A Versatile, Genetically Encoded FRET Sensor for Cytosolic and Intraorganelle Zn(2+) Imaging... -
Control AAV Preps
TypeCollection... 1, 2, 5, 8, 9, 11, rg*, PHP.eB Bryan Roth 50469 pAAV-CaMKIIa-EGFP CaMKIIa EGFP Constitutive 1, 2, 5, ...Constitutive 2 Marcella Patrick 114469 pAAV-CaMKIIa-mCherry CaMKIIa mCherry Constitutive 1, 2, 5, 8, 9, ...Constitutive 1, 2, 5, 8, 9, rg* Karl Deisseroth 117382 hSyn1-eYFP hSyn eYFP Constitutive 1, 2, 5, 8, 9, rg...dependent 1, 2, 5, 9, rg* Karl Deisseroth 28306 pAAV-FLEX-tdTomato CAG tdTomato Cre dependent 1, 2, 5, 8, 9...dependent 1, 2, 5, 8, 9, rg* Bryan Roth 50459 pAAV-hSyn-DIO-mCherry hSyn mCherry Cre dependent 1, 2, 5, 8, ...dependent 1, 2, 5, 8, 9, rg* Karl Deisseroth 55641 pAAV-Ef1a-fDIO EYFP EF1a EYFP Flp dependent 1, 2, 5, 8, ...Serotype PI 37825 AAV-CAG-GFP CAG GFP Constitutive 1, 2, 5, 6, 8, 9, 11, rg*, PHPeB, CAP-B10, CAP-B22, MaCPNS1... -
Genetic Code Expansion
TypeCollection...Schultz 48696 pANAP AnapRS E. coli 3-(6-acetylnaphthalen-2-ylamino)-2-amino-propanoic acid (Anap) Mammalian...4xEcoLeuT(CUA)_AnapRS AnapRS E. coli 3-(6-acetylnaphthalen-2-ylamino)-2-amino-propanoic acid (Anap) Mammalian...Mammalian TAG Huiwang Ai 73544 pEvol-pAcFRS.2.t1 pAcFRS.2.t1 E. coli p-acetyl-l-phenylalanine (pAcF) Bacterial...Bacterial TAG Farren Isaacs 73546 pEvol-pAzFRS.2.t1 pAzFRS.2.t1 E. coli p-azido-l-phenylalanine (pAzF) Bacterial...archaeon S-(4-cyanopyridin-2-yl)-L-cysteine (CysCNP) and S-(4-cyanopyrimidin-2-yl)-L-cysteine (CysCNPym)...Jesse Rinehart 71403 pCMV-DnpK PylRS M. barkeri N6‐(2‐(2,4‐dinitrophenyl)acetyl)lysine (DnpK) Bacterial,...pDule-IBBN (G2) IBBN (G2) synthetase M. jannaschii 4-(2′-bromoisobutyramido)-phenylalanine (IBBN) and structurally... -
p53 Pathway
TypeCollection...CCNB1 CCNB2 CCNB3 Cyclin B1, 2, or 3 Cyclin D CCND1 CCND2 CCND3 Cyclin D1, 2, or 3 Cyclin E CCNE1 CCNE2 ...kinase 1 CHK2 Checkpoint kinase 2 Cop-1 Ring finger and WD repeat domain 2 (RFWD2); E3 ubiquitin protein...SESN3 Sestrins 1, 2, or 3 Siah Siah E3 ubiquitin protein ligase 1 TSC2 Tuberous sclerosis 2 TSP1 Thrombospondin... Spring Harbor Perspectives in Biology. 2010 Feb;2(2):a001107. PMC PMID: 20182618 . Do you have suggestions...threonine kinase ATR ATR serine/threonine kinase B99 G-2 and S-phase expressed 1; also known as GTSE1 BAI-1...inhibitor 1A p48 Damage-specific DNA binding protein 2, 48kDa p53 Tumor protein p53 p53AIP1 Tumor protein... domain protein 1 PIGs Etoposide induced 2.4 PIRH-2 Ring finger and CHY zinc finger domain containing ... -
Immunology Research Plasmids and Resources
TypeCollection...immunoglobulin heavy diversity 2-15 D2, IGHD215 IGHD2-2 immunoglobulin heavy diversity 2-2 IGHD22 IGHD2-21 immunoglobulin...heat shock 70kDa protein 2 HSP70-2, HSP70-3 HSPA4 heat shock 70kDa protein 4 APG-2, HS24/P52, MGC131852, ...variable 2-33 (non-functional) IGLV233, V1-9 IGLV2-8 immunoglobulin lambda variable 2-8 IGLV28, V1-2 IGLV3...beta 4 DEFB-2, DEFB102, DEFB2, HBD-2, SAP1 EDN1 endothelin 1 ET1, HDLCQ7 EDN2 endothelin 2 ET2, PPET2 ...receptor subfamily 2, group C, member 1 TR2 NR2C2 nuclear receptor subfamily 2, group C, member 2 TAK1, TR2R1...suppression of tumorigenicity 2 - STC1 stanniocalcin 1 STC STC2 stanniocalcin 2 STC-2, STCRP TAC1 tachykinin,...HPS, HPS2, PE AZGP1 alpha-2-glycoprotein 1, zinc-binding ZA2G, ZAG B2M beta-2-microglobulin - CALR calreticulin... -
Allen Institute for Cell Science Plasmid Collection
TypeCollection...Transcription factor SOX-2 Transcription Factor 124607 ACTN2-mEGFP AICSDP-63 mEGFP Alpha-actinin-2 Sarcomeric z-disks...101781 CETN2-mTagRFP-T AICSDP-22 mTagRFP-T Centrin-2 Centrioles 101782 LAMP1-mEGFP AICSDP-19 mEGFP LAMP... AICSDP-83 mEGFP EZH2 Polycomb repressive complex 2 164500 POLR2A-mEGFP AICSDP-117 mEGFP RPB1 RNA polymerase...mEGFP AICSDP-77 mEGFP Telomeric repeat-binding factor 2 (TRF2) Telomeres 168799 CTCF-mEGFP AICSDP-144 mEGFP...Nucleolus (granular component) 133963 UBTF-HaloTag AICSDP-80 HaloTag Nucleolar transcription factor UBF Nucleolus... -
Zhang Lab CRISPR Page
TypeCollection...SpCas9n with 2a-Puro and 2a-EGFP are also available. 2. SpCas9 (or SpCas9n, D10A nickase) + CRISPR RNA array... system - lentiCRISPR - sgRNA and SpCas9 together 2 vector system - lentiCas9-Blast and lentiGuide-Puro...two MS2 RNA aptamers at the tetraloop and stemloop 2 The MS2-P65-HSF1 activation helper protein Full references...backbone with MS2 loops at tetraloop and stemloop 2 and EF1a-zeo resistance marker. Contains BsmBI sites...inverted terminal repeats (ITR) from AAV serotype 2. SaCas9 only: This plasmid ( PX600, #61592 ) contains...Epub 2013 Aug 29. Erratum in: Cell. 2013 Oct 10;155(2):479-80. PubMed . Genome engineering using the CRISPR-Cas9... Feng G, Sharp PA, Zhang F. Cell . 2014 Oct 9;159(2):440-55. doi: 10.1016/j.cell.2014.09.014. Epub 2014... -
Validated gRNA Sequences
TypeCollection...23792628 Joung fbf-2 C. elegans GTAGTCACGGCGATGATTA 65597 cut S. pyogenes 25249454 Seydoux fbf-2 C. elegans TAATCATCGCCGTGACTAC...Mashimo Kit-2 R. norvegicus CTAACGTTCCAGCGCTCGTT 60970 cut S. pyogenes 24967838 Mashimo Kit-2 R. norvegicus... & Lim swan-2 C. elegans ACAAATTGATATCCAATCA 66100 cut S. pyogenes 25249454 Seydoux swan-2 C. elegans ...AMPK alpha 2 H. sapiens GTCAGCCATCTTCGGCGCGCG 74376 nick S. pyogenes 26816379 Shaw AMPK alpha 2 H. sapiens.... pyogenes Fungal Biology and Biotechnology 2015, 2:4 Hong Ctnnb1 M. musculus AGCTCCTTCCCTGAGTGGCA 59912...26355004 Mendenhall CEBPB H. sapiens GCCGGCAGGGGGACGCGCGCGG 64047 tag S. pyogenes 26355004 Mendenhall Cent1...26355004 Mendenhall CREB1 H. sapiens GCCACAAATCAGATTAATTTGGG 64939 tag S. pyogenes 26355004 Mendenhall csr-... -
CRISPR Pooled gRNA Libraries
TypeCollection...3rd 1, 2, or 4 49,766 arrays Broad GPP kinome Brunello 75314, 75315 (1 plasmid) 75312, 75313 (2 plasmid...GPP genome-wide Brunello 73179 (1 plasmid) 73178 (2 plasmid) Knockout Human Doench and Root 3rd 4 76,441...Broad GPP genome-wide Brie 73632 (1 plasmid) 73633 (2 plasmid) Knockout Mouse Doench and Root 3rd 4 78,637...172651 (Set D) Knockout Human Doench and Root 2nd 2 40,710 Inzolia Human CRISPR/Cas12a Multiplex Knockout...3,052 Broad GPP kinome Brie 75317 (1 plasmid) 75316 (2 plasmid) Knockout Mouse Doench and Root 3rd 4 2,852...MinLibCas9 Library 164896 Knockout Human Garnett 3rd 2 37,722 Green monkey (Chlorocebus sabaeus) sgRNA library...Library (Gattinara) 136986 Knockout Human Doench 3rd 2 40,964 Ingolia lab S cerevisiae CRISPRi v1 – barcodes... -
Rett Syndrome
TypeCollection... mutations in the gene methyl-CpG binding protein 2 ( MECP2 ). MECP2 Rett syndrome is an X-linked disorder...X-linked MECP2, encoding methyl-CpG-binding protein 2. Nat Genet . 23, 185–188. (Link opens in a new window... Cuddapah et al. 2014. Methyl-CpG-binding protein 2 (MECP2) mutation type is associated with disease severity... Specific mutations in methyl-CpG-binding protein 2 confer different severity in Rett syndrome. Neurology...males with mutations in Methyl-CpG binding protein 2. Am J Med Genet B Neuropsychiatr Genet . 180, 55–67... results in approximately half of cells expressing wild-type MECP2 and half expressing mutant MECP2 . ...Kankirawatana et al. 2006. Early progressive encephalopathy in boys and MECP2 mutations. Neurology . 67... -
Allen Institute for Brain Science AAV Enhancer Collection
TypeCollection...Layer 2-3_IT Isocortex 230803 pAAV-AiE2638m-minBG-iCre(R297T)-BGHpA AiP20142 AiE2638m Cre Layer 2-3_IT ...Layer 2-3_IT Isocortex 220727 pAAV-AiE2543m-minBG-iCre(R297T)-BGHpA AiP2048 AiE2543m Cre Layer 2-3_IT ...Layer 2-3_IT Isocortex 230402 pAAV-AiE0680m-minBG-iCre(R297T)-BGHpA AiP15072 AiE0680m Cre Layer 2-3_IT ...AiE0027m_3xC3 SYFP2 Ventromedial hypothalamic nucleus (VMH) Hypothalamus 230531 pAAV-AiE2150m-minBG-SYFP2...formation Cortical subplate Striatum Pallidum Hypothalamus Cerebellum Whole brain Addgene ID Plasmid Allen... -
Biosensor AAV Preps
TypeCollection...dependent 1, 2, 5, 9 Kim , GENIE 100836 pAAV.CAG.GCaMP6f.WPRE.SV40 CAG GCaMP6f none Constitutive 1, 2, 9 Kim...Constitutive 1, 2, 9 Campbell Calcium Sensor: HaloCaMP1a 138327 pAAV-synapsin-HaloCaMP1a-EGFP Syn HaloCaMP1a EGFP..., Huebener , Rose 83899 pAAV-mDlx-GCaMP6f-Fishell-2 Dlx GCaMP6f none Constitutive 1, 9, rg* Fishell 100833....v857.PDGFR CAG iGluSnFr3 v857 none Cre dependent 2 Podgorski 234437 pAAV-syn-iGluSnFR4s-NGR-WPRE Syn ...pAAV-hSyn-GRAB_g5-HT3.0 Syn GRAB_g5-HT3.0 none Constitutive 1, 2, 8 Li No available items found to match all requested...Schreiter Calcium Sensor: HaloCaMP1b 138328 pAAV-synapsin-HaloCaMP1b-EGFP Syn HaloCaMP1b EGFP Constitutive 1...jRGECO1 sRGECO Far-Red/NIR Calcium Sensors HaloCaMP1a HaloCaMP1b NIR-GECO Acetylcholine Sensors iAChSnFR ... -
TALEN Guide
TypeCollection...par with ZF arrays, if not slightly lower. Figure 2: Simplified representation of the Voytas/Bogdanove...variety of backbones in just a few steps ( Figure 2 ). The Bogdanove group also hosts web-based software...mammalian transcription. Nat Biotechnol. 2011 Feb;29(2):149-53. PMID: 21248753 . TALEs for the masses. Rusk...led by Jens Boch at the Martin-Luther-University Halle-Wittenberg and Adam Bogdanove at Iowa State University...into a single construct would be technically challenging. Thanks to efforts by the Bogdanove group and... -
CRISPR History and Development for Genome Engineering
TypeCollection...transcribed to make the pre-CRISPR RNA (pre-crRNA). (2) The pre-crRNA is processed into individual crRNAs...2015. Class 1 (Multi-subunit effector complex) Class 2 (Single multi-domain effector) Type I (Cas3) Type ... with unprecedented speed and specificity. Figure 2: An overview of CRISPR and NHEJ/HDR. The Cas9/gRNA...regulation of transcription in eukaryotes. Cell . 154(2):442-51. PMID: 23849981 Ishino Y, Shinagawa H, Makino...Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell . 163(3):759-71. PMID: 26422227...WX, Scott DA, Gootenberg JS, Kriz AJ, Zetsche B, Shalem O, Wu X, Makarova KS, Koonin EV, Sharp PA, Zhang...Smith SB, Meadows SK, Roberts BS, Mackiewicz M, Mendenhall EM, Myers RM. 2015. CETCh-seq: CRISPR epitope... -
Plasmids for Stem Cell Research
TypeCollection...mouse somatic cells. Cell Stem Cell. 2008 Feb 7. 2(2):151-9. Jaenisch Lentivirus Mouse Polycistronic, ...Nature of Induced Pluripotency. Cell. 2015 Jul 16;162(2):412-24. Mikkelsen Lentivirus Human Expression of ...self-replicative RNA. Cell Stem Cell. 2013 Aug 1;13(2):246-54. Dowdy Adenovirus Mouse Non-integrating expression...reprogramming in mouse. Cell Stem Cell. 2008 Mar 6. 2(3):230-40. Hochedlinger MMLV-derived Retrovirus Mouse...Lentiviral Human Small molecules enable neurogenin 2 to efficiently convert human fibroblasts into cholinergic...Conversion of Fibroblasts. Neuron. 2014 Oct 22;84(2):311-23. Yoo Fibroblasts Neurons Lentiviral Human ...