Skip to main content

We narrowed to 267 results for: ttl

Showing: 1 - 20 of 267 results
  1. Plasmids 101: Shuttle Vectors

    Type
    Blog Post
    ...mammalian vectors are designed to shuttle between species. Figure 1: Shuttle vectors are vectors that can...! Wait, what even counts as a shuttle vector? Are viral vectors shuttle vectors? The production of viral...host range plasmids shuttle vectors? While it’s technically accurate to say that shuttle vectors have a “...lecture slide. That shared language is the basis of shuttle vectors, which can function in unrelated host species...species. Created with BioRender.com. How are shuttle vectors different from other plasmids? If we all...cells and get on with my experiment? Not quite. Shuttle vectors have to address several big differences...recognized by its host’s replication machinery. A shuttle vector designed for unrelated bacteria should include...
  2. The Materials Science of Optogenetics Experiments

    Type
    Blog Post
    ...the laser power source itself. Pulse generation (TTL pulse) is a standard electronics protocol not specific...experiments we discussed last week are only half of the battle when using optogentics to answer a research question...
  3. Adenovirus Plasmids

    Type
    Collection
    ...genomic DNA stuffer Vogelstein 18703 pEZYshuttle Shuttle Modified pShuttle-CMV plasmid with Gateway cassette...recombining shuttle plasmids Vogelstein 16401 pAdEasy-2 Adenoviral For recombining shuttle plasmids; for...insertion of GFP expression cassette. Bunz 16402 pShuttle Shuttle For production of viruses containing transgene...under a chosen promoter Vogelstein 16403 pShuttle-CMV Shuttle For production of viruses containing transgene...containing transgene under CMV Bamburg 50958 ShuttleNSE Shuttle For production of viruses containing transgene...Neuron-specific enolase (NSE) promoter Bamburg 50959 ShuttleMCP Shuttle For production of viruses containing transgene...cofilin promoter (MCP) Bamburg 62621 pShuttle-CMV-F2A-T2A-Venus Shuttle For production of viruses with multicistronic...
  4. Brzezinski Lab CRISPR Collection

    Type
    Collection
    ...nuclear reporters via an H2B fusion shuttle plasmid for shuttling U6-guide cassettes to make dual guide...same plasmid by utilizing one of the dual guide shuttle plasmids to insert a second guide within a U6-guide...
  5. Kazuhiro Oka Lentiviral Vectors

    Type
    Collection
    ...73355 Adeno X shuttle vector with EF1 promoter and SV40 polyA pICPIS-CB 73356 AdenoX shuttle vector with...can be cloned into these transfer vectors using shuttle vectors pICPIS-EF1 (Addgene #73355) and pICPIS-...
  6. Synthetic Biology - Cloning and Genomic Tools

    Type
    Collection
    ...Library Construction Integration Recombination Shuttle Vectors Plasmids for Cloning and Genomic Tools .../Insert Vector Type PI Publication Back to Top Shuttle Vectors Search the table by keyword or sort by ...
  7. Validated gRNA Sequences

    Type
    Collection
    ...25139909 Cate Mettl14 M. musculus GCCGCTCCCGGATCTCCTGC 61514 nick S. pyogenes 25569111 Hanna Mettl14 M. musculus...
  8. Synthetic Biology - Overview

    Type
    Collection
    ...to cloning and genomic modification, including shuttle, integration, reporter, and tagging vectors. Metabolism...
  9. Viral Vector Guides and Plasmids

    Type
    Collection
    ...genetic information to be delivered (transfer or shuttle plasmid) and one or more plasmids containing the...
  10. Plant Plasmids and Resources

    Type
    Collection
    ...JoinTRV , an improved vector system based on tobacco rattle virus (TRV) that simplifies gene silencing and ...
  11. CRISPR Plasmids - Plants

    Type
    Collection
    ...snoRNA U3 BsaI none S. pyogenes Yang 47024 pUC gRNA Shuttle Mt U6.6 inFusion none S. pyogenes Parrott 50591...
  12. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...160436 pUCIDT-attL1-Human ABeta-attR5 APP Alzheimer's Nicholas Tolwinski 160437 pUCIDT-attL1-Worm ABeta-...Fawzi 127616 myc-KIF5A KIF5A Myc CMV ALS Josef Kittler 128510 pPHAGE-CR-PINK1-C-TAP PINK1 Flag, HA CMV...-eGFP-C1-VPS35 VPS35 GFP CMV Parkinson's Josef Kittler 163858 VPS35 shRNA1 VPS35 Parkinson's Lei Lu 163859...
  13. Plan Your Experiment

    Type
    Collection
    ...DNA to serve as template for the repair. Once you settle on your gRNA, you can design a donor DNA to have...
  14. Antibody Guide

    Type
    Collection
    ...produce large amounts of a single antibody with little variation. Recombinant plasmids - Antibodies can...
  15. Plasmids 101: Gateway Cloning

    Type
    Blog Post
    ...recombination sites (attL-left- and attR-right-, Figure 1). Under certain conditions, the attL and attR sites...into an attL-entry-TOPO vector. TOPO cloning adds short end(s) to facilitate cloning into an attL-containing... and a attL-entry vector. This fragment is inserted in a multiple cloning site (MCS) of an attL-containing... attP1 sites; attB2 only with attP2, attL1 only with attR1; attL2 only with attR2, and so on. Take a look...reactions. Recombination of attP and attB sites creates attL and attR sites.   Gateway vectors contain modified... clone containing the DNA of interest flanked by attL sites. As a byproduct of the reaction, the ccdB ... BP and LR reactions. The BP reaction creates an attL-flanked entry clone. The LR reaction creates an ...
  16. Selecting Your Plasmid Purification Kit

    Type
    Blog Post
    ...quality required. Some applications require very little DNA and you can get away with slightly lower quality... in a lysis buffer for too long or if you get a little overzealous with your pipetting. Another is the...from the more obvious swaps like using smaller bottles or recycled cardboard packaging, there are some...concentrated buffers reduces plastic waste from bottles and the overall weight of the package during shipping...materials Reduced plastic in spin columns and buffer bottles Waste tubes are made of 100% post-consumer ...post-consumer recycled plastic Reduced plastic in buffer bottles Fewer plastic consumables Fewer pipette tips ...you to run thousands of reactions with relatively little work after the initial setup. (Addgene actually...
Showing: 1 - 20 of 267 results