We narrowed to 268 results for: ttl
-
TypeGuide...CTACAAACTCTTCCTGTTAGTTAG 5' of attL1 in pENTR vector Forward pENTR-R ATGGCTCATAACACCCCTTG 3' of attL2 in pENTR vector...
-
Molecular Cloning Techniques
TypeGuide... entry clone. The entry clone now has recombined attL sites flanking your DNA fragment of interest. Now...vectors deposited with Addgene), it can be rapidly shuttled into any compatible Gateway destination vector... -
Protocol - How to Inoculate a Bacterial Culture
TypeProtocol...Loosely close the cap on the bottle (do NOT close all the way or the bottle may explode!) and then loosely...LB, weigh out the following into a 500 mL glass bottle: 4 g NaCl 4 g Tryptone 2 g Yeast Extract and dH...loosely cover the entire top of the bottle with aluminum foil. Autoclave and allow to cool to room temperature...temperature. Now screw on the top of the bottle and store the LB at room temperature. When ready to grow ... -
Protocol - How to Run an Agarose Gel
TypeProtocol...usually use one or the other, but there is very little difference between the two. Note: Make sure to ...increases the density of your DNA sample causing it settle to the bottom of the gel well, instead of diffusing...later use, use long-wavelength UV and expose for as little time as possible to minimize damage to the DNA.... -
Molecular Biology Protocol - Restriction Digest of Plasmid DNA
TypeProtocol...ideal conditions with very clean DNA, so using a little more enzyme is advisable. Reactions are often performed...enzyme than you will need, but that's okay because a little more enzyme is usually better. Mix gently by pipetting... -
Pipetting Protocol
TypeProtocol...Containers to hold measured liquid (ex: microfuge tube, bottle, etc.) Labels for containers Reagents Liquid for...measured liquid (ex: another microcentrifuge tube, a bottle etc.). If there is already other liquid in the ... -
Transfection for Recombinant Antibodies
TypeProtocol...PEI-MAX powder to 900 mL deionized water in a 1 L bottle and stir on a magnetic stir plate. Stir until all...into a clean microcentrifuge tube. Pro-Tip Cells settle quickly and need to be resuspended before sampling... -
Coomassie Purity Stain of Recombinant Antibodies
TypeProtocol...X PBS, 1X pH 7.4, VWR 45000-446 250 mL sterile bottles, Corning 430281 Deionized water IgG isotype standard...LC) proteins, respectively. There should be very little background staining. Pro-Tip A large shift in the... -
Affinity Purification of Recombinant Antibodies with Protein A or Protein G
TypeProtocol...pH 9.0, Millipore Sigma T2819-1L 250 mL sterile bottle, VWR 430281 0.45 µm PES complete filtration unit...Gravitrap column. Collect the flow through in a 250 mL bottle. Repeat steps 9–10 such that the supernatant passes... -
Antibody Validation Using the Indirect ELISA Method
TypeProtocol... Pipettes, 10 mL, VWR 89130-898 1 L polystyrene bottle, Corning 430518 PBS, 1X pH 7.4, VWR 45000-446 TMB... mL of Tween-20 to into 999.5 mL 1X PBS Cap the bottle and invert several times to mix. Carefully remove... -
Isolating a Monoclonal Cell Population by Limiting Dilution
TypeProtocol...stable alternative, such as glutaGRO) To a 500 mL bottle of DMEM high glucose, add 55 mL of heat-inactivated...especially in the corner of the well as cells tend to settle there. Once the cells have expanded but before ... -
Guide to Using Pooled Libraries
TypeGuide...winners’. Negative Screen Negative screens are a little trickier than positive screens. In a negative screen... -
Plan Your Experiment
TypeGuide...DNA to serve as template for the repair. Once you settle on your gRNA, you can design a donor DNA to have... -
Adeno-associated virus (AAV) Guide
TypeGuide...Delivery relative to transgene Purpose Transfer/Shuttle plasmid 5' ITR (LITR) in cis Left Inverted Terminal... -
Antibody Guide
TypeGuide...produce large amounts of a single antibody with little variation. Recombinant plasmids - Antibodies can... -
DNA Quantification
TypeProtocol...accurately read DNA concentration and purity in as little as 1μl. Regardless of whether you have a NanoDrop... -
Personal Protective Equipment (PPE) for BSL-1 and BSL-2 Labs
TypeProtocol... for labs working with low-risk microbes posing little to no threat of infection or disease in healthy... -
Protocol - How to Purify DNA from an Agarose Gel
TypeProtocol...from being cut by the razor blade. Try to get as little excess gel around the band as possible. To do so... -
Fluorescence Titering Assay
TypeProtocol...stable alternative, such as glutaGRO) To a 500 mL bottle of DMEM high glucose, add 55 mL of heat-inactivated... -
General Transfection
TypeProtocol...stable alternative such as glutaGRO) To a 500 mL bottle of DMEM high glucose, add 55 mL of heat-inactivated...