Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 322 results for: phy

Showing: 301 - 320 of 322 results

  4. Typing CRISPR Systems

    Type
    Blog Post
    ...relies on a combination of sequence similarity, phylogenetic analysis, neighborhood analysis of surrounding...

  11. Deep Dive: qPCR

    Type
    Blog Post
    ...can up-regulate the expression of GAPDH. Biochem Biophys Res Commun. 2001 Mar 9;281(4):951-6. doi: 10.1006...

  12. Using AAV for Neuronal Tracing

    Type
    Blog Post
    ... with other neuroscience methods such as electrophysiological recordings. The origins of these methods...

  13. 15 Hot Plasmids from 2017

    Type
    Blog Post
    ...popular Optogenetics tools use light to alter cell physiology and molecular processes via genetically encoded...

  15. Chemogenetics Guide

    Type
    Guide
    ...neurons expressing the LMO, depending on its biophysical properties. While LMOs provide chemogenetic access...Tools for Causal Cellular and Neuronal Biology. Physiol Rev. 98:391–418. PMID: 29351511 (Link opens in ...Luminopsins integrate opto- and chemogenetics by using physical and biological light sources for opsin activation...26733686 (Link opens in a new window) Björefeldt A, Murphy J, Crespo EL, Lambert GG, Prakash M, Ikefuama EC...

  16. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...disease, spinal muscular atrophy, hemophilia A and B, and Duchenne muscular dystrophy. Many clinical trials...be included between the ITRs is limited by the physical space available inside of the small AAV capsid...smaller Cas9 orthologs, such as SaCas9 from Staphylococcus aureus . The Feng Zhang lab has developed plasmids...

  17. CRISPR Guide

    Type
    Guide
    ... Cas9 orthologs are available. SaCas9 (from Staphylococcus aureus ) has a coding sequence ~1 kb shorter...NGNG xCas9 3' NG, GAA, or GAT SpCas9-NG 3' NG Staphylococcus aureus (SA); SaCas9 3' NNGRRT or NNGRR(N) Acidaminococcus...Zhang, F. (2015). In vivo genome editing using Staphylococcus aureus Cas9. Nature , 520 (7546), 186–191. ...immunoprecipitation (enChIP) using CRISPR. Biochemical and Biophysical Research Communications . 439 (1), 132–136. PMID...

  18. Promoters

    Type
    Guide
    ...back on itself which helps to explain how many physically distant DNA sequences can affect transcription...

  19. Sequencing Primers

    Type
    Guide
    ...origin, 3' of MCS in pGP704 vector, reverse primer pHybLex Reverse GAGTCACTTTAAAATTTGTATACAC (Invitrogen) ...

  20. Adenovirus Guide

    Type
    Guide
    ...be included between the ITRs is limited by the physical space available inside of the adenoviral capsid...
Showing: 301 - 320 of 322 results