We narrowed to 735 results for: RAN-1

...and biotin plasmids at Addgene!     Figure 1: Indirect detection of target markers can be achieved...can be motifs within transmembrane proteins, such as receptors, or post-translational modifications on those...diffuse through the cell membrane freely, while others require a permeabilized membrane to enter cells. Depending...label intranuclear proteins of interest, you can label cytosolic proteins alongside the intranuclear ones...Depending on the application, they can be membrane-permeant or membrane-impermeant, and the cells of interest...viability dyes are membrane-impermeant and can only enter cells with compromised plasma membranes — i.e., dead...conjugates are commercially available for a wide range of fluorophores, allowing for great flexibility ...

...determined for your sample. Typical ratios may range from 1:1 to 1:6. Add the diluted PEI-MAX to the diluted...solution at -20 °C. 1 mg/mL PEI-MAX Add 1 g of PEI-MAX powder to 900 mL deionized water in a 1 L bottle and ...to mix. Add 450 µL of 1 mg/mL PEI-MAX to the second tube of 6 mL BCD TFX (for a 1 mg/mL stock solution ...antibody At 168 hours (1 week) post-transfection, harvest the antibody. Transfer the HEK293 cells and media...February 18, 2022 Workflow Timeline Day 1: Seed cells Day 2: Transfect cells Day 3-6: Feed cells Day 7: Harvest...at -20 °C. Procedure Section 1: Seeding cells The day prior to transfecting, seed a 108 mL culture of HEK293.... Cap the tubes and incubate for 1 h in the 37 °C bead bath. Transfer the PEI-MAX and recombinant antibody...

... phototropin 1 LOVETRAP reversibly sequester and release proteins from cellular membranes using light....algae Chlamydomonas reinhardtii . Channelrhodopsin-1 (ChR1) is excited by blue light and permits nonspecific...diversifying and extending optogenetics. Cell, 141 (1), 154–165. https://doi.org/10.1016/j.cell.2010.02.037...limitations and future developments. Exp Physiol, 96 (1), 19–25. https://doi.org/10.1113/expphysiol.2009.051961...Biol, 1408 , 141–165. https://doi.org/10.1007/978-1-4939-3512-3_10 PMID: 26965121 Yizhar, O., Fenno, L...wavelengths, ranging from blue to yellow to red. Red light exhibits better tissue penetrance, which may ...including protein activation, membrane localization, and transcriptional activation. In the widely used...

...sense or coding strand of the transcribed gene (Figure 1). The coding strand is the DNA strand that encodes...noncoding strand, as this is the strand that is transcribed by the RNA polymerase. Figure 1: Simplified promoter...Mammalian Strong promoter from human elongation factor 1 alpha PGK Constitutive Mammalian Promoter from phospholycerate...to the mRNA transcript produced. The antisense strand is referred to as the template strand or noncoding...initiation of transcription, whereas transcription factors promote the initiation of transcription. The binding...template for the translation of a protein. RNA polymerase III — transcribes genes encoding transfer RNAs (tRNA... eukaryotic promoters, including transcription and the transcription complex. Educational...

...get more colonies if you use 1 μl of a 1:5 or 1:10 dilution rather than 1 μl directly.... 20-30 mins. Heat shock each transformation tube by placing the bottom 1/2 to 2/3 of the tube into a 42...and then (optional) incubate in 37°C incubator. Mix 1 - 5 μl of DNA (usually 10 pg - 100 ng) into 20-50 ...Introduction Transformation is the process by which foreign DNA is introduced into a cell. Transformation of bacteria... more easily transformed and that will help to maintain the plasmid without rearrangement of the plasmid...prepared for optimal transformation efficiencies upon thawing. For the highest transformation efficiency, we...Pro-Tips Commercial competent cells range significantly in their transformation efficiency. The lowest efficiency...

...mycoplasma can even escape 0.2-micron filters. Figure 1: Contamination! Tissue culture media often have indicators..., and effective for wide range of mycoplasma. These methods cannot guarantee complete removal of mycoplasma...the media after autoclaving hence, there is no assurance of the serum being contamination free. The aerosols...commonly infecting mycoplasmas are used. A broad range of primers encompasses almost all the infecting ...filters, for media filtration. There is no 100% assurance that this process can avoid contamination but ...

...GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward...CGTCAGCAGAGCTTCACCATTG 3' end of LexA DNA binding domain Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward... MT1-F GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter Forward mU6-F CAGCACAAAAGGAAACTCACC Mouse...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward SP6 ATTTAGGTGACACTATAG SP6 promoter Forward...recombinase Reverse CYC1 GCGTGAATGTAAGCGTGAC CYC1 transcriptioin termination signal/td> Reverse DsRed1-C AGCTGGACATCACCTCCCACAACG...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward pGP704-R AACAAGCCAGGGATGTAACG R6K gamma...Reverse Tn7-end GGGGTGGAAATGGAGTTTTT Bacteria transposon Tn7 Reverse? TRC-F CAAGGCTGTTAGAGAGATAATTGGA ...

...expression of the full-length transgene, but also at a very low efficiency (less than 1% of wild-type). Another...replication and also act as signals for packaging. Figure 1: Wild-type AAV genome. Created with BioRender.com....extensively studied, and has a broad tissue tropism. Table 1 gives a summary of the tropism of AAV serotypes, indicating...AAV5, AAV8 Skeletal muscle AAV1, AAV8, AAV9 Table 1: Summary of tissue tropism displayed by different ...vectors pseudotyped with viral capsids from serotypes 1, 2, and 5 display differential efficiency and cell...double-stranded DNA genome. Adeno-associated viruses (AAV), however, are small single-stranded DNA viruses...plasmids are needed: Transfer plasmid (also known as cis plasmid) — containing the transgene of interest between...

...enzyme and guide RNA) for your experiment (Figure 1). You will decide how to express Cas9, the delivery...finally how to validate your genetic edit. Figure 1: Flow chart describing the general framework of a ...population. Some cells may remain wild type due to either (1) a lack of gRNA and/or Cas9 expression or (2) a lack...Biology , 1239 , 197–217. https://doi.org/10.1007/978-1-4939-1862-1_10 PMID: 25408407 Dixit, A., Parnas, O...fused to transcriptional activators that need to be within a given range of the transcription start site... interfere with transcription elongation. CRISPR Activation : Target the transcription start site. CRISPRa... perform by chemical transfection or electroporation. Expression can be transient, or you can generate...

...halorhodopsins to silence neuronal activity (Figure 1) (Wiegert et al., 2017). How to get an opsin into...flow of electric charges across cell membranes and maintain membrane potential in response to visible light...across the axon's membrane: once a certain number of positive ions crosses the cell membrane, a threshold ...rhodopsins enable ions to flow across the axon’s membrane, thereby controlling neural activity (Bernstein...the opsin into the correct orientation to be transcribed (Figure 2) (Sharma and Zhu, 2014). How does FLEx... optogenetic FLEx vectors in combination with transgenic animals or rAAVs expressing Cre under a specific...the mechanisms of sleep and anesthesia. In Cre transgenic mice, they targeted the dopamine (DA) neurons...

... DNA fragments of interest, such as genes. Figure 1: Creation of recombinant DNA. Working with Plasmids...U169 recA1 endA1 hsdR17(rk-, mk+) phoA supE44 thi-1 gyrA96 relA1 tonA EPI300 LGC Biosearch Technologies...Addgene; Promega e14-(McrA-) recA1 endA1 gyrA96 thi-1 hsdR17(rK- mK+) supE44 relA1 Δ(lac- proAB) [F traΔ36...galK2 lacY1 proA2 rpsL20 (StrR ) xyl-5 λ- leu mtl-1 Top10 Invitrogen F- mcrA Δ(mrr-hsdRMS-mcrBC) Phi80lacZM15...molecular biology, that proteins are translated from RNA, which is transcribed from DNA. The Genetic Code The..., double-stranded helix. To create the double helix, the nucleotides on the opposing strands of DNA form...proteins can be translated, the DNA is converted to RNA in a process called transcription. RNA uses the ...

...a short-term position (1-2 years) Often a gap-year position taken to transition to the next career stage...investigator. In basic science (as opposed to translational, biomedical, or applied sciences), people conduct...don’t tell us everything there is to know is a strange and exciting revelation. Science in any field can...investigator (PI) Runs the lab Writes a lot of grants Varying degrees of engagement with what happens...

...experience in cancer research After graduating with a 2:1 BSc in Molecular Biology (roughly a B average in the...project to validate some genomic changes, so this arrangement was ideal for everyone.  The cutting edge science...young scientists and PhD students to also explore a range of alternative careers outside of acidemia to have...

...gamma-retroviruses ranges from 9–11 kb, encoded on RNA (Figure 1). This RNA is reverse transcribed into the provirus...producing viral vectors in a laboratory setting. Figure 1: Wild-type gamma-retrovirus genome. Created with BioRender.com... Increases transduction efficiency and transgene expression. Packaging plasmid gag in trans Precursor ...crossover event between the transfer plasmid and genes provided in trans . Transduction The process of artificially...need three plasmids (Figure 2): Transfer plasmid — contains transgene, sgRNA, or shRNA of interest flanked...Production Cloning Cloning your transgene, gRNA, or shRNA of interest into the transfer plasmid can be done with...described above (envelope, packaging, and transfer) are co-transfected into the HEK293T packaging cell line...

...also negatively affect data reproducibility. Figure 1: Simplified flow chart for amplifying and using a ...Barcoding libraries contain plasmids with unique, semi-random sequences that can be used for applications like...large numbers of cells minimizes the effects of random chance that could lead to false positive or negative...

...and placed in a buffer. Antibody Structure Figure 1: Structure of an antibody A standard antibody is made... together to form a “Y” shape, as shown in Figure 1. The two arms of the Y structure are responsible for...proteins by size. Transfer proteins from the gel to a membrane. Incubate the membrane with an unconjugated...block the membrane to remove excess antibody and prevent unwanted binding. Incubate the membrane with a ...Wash and block the membrane. Activate the HRP with a substrate kit. Image the membrane using either X-ray...hybridoma cells into plasmids. Plasmids are then transfected into cells and induced to express antibodies....variable regions, shown in light blue and light orange, that bind to a specific antigen, triggering an...

...more in our Restriction Cloning blog post . Figure 1: Restriction enzyme cloning of your gene of interest...by certain bacteria and archaea, cleave double-stranded DNA (dsDNA) at specific sequence sites in the ...into fragments containing precise 5' or 3' single-strand overhangs (sticky ends), or no overhang (blunt ... They also cut specific target sequences, which range from four to 13 base pairs, and produce predictable... with four nicks that bacteria repair after transformation. LIC does not require site-specific recombination...exonuclease until a base is exposed on the single-strand overhang that is complementary to the free nucleotide... is rendered unnecessary. The product may be transformed directly into E. coli , where the normal replication...

...Consortium A.2 Map of pLKO.1 A.3 Related plasmids B. Designing shRNA Oligos for pLKO.1 B.1 Determine the optimal...Order oligos compatible with pLKO.1 C. Cloning shRNA oligos into pLKO.1 C.1 Recommended materials C.2 Annealing... References H.1 Published articles H.2 Web resources I. Appendix I.1 Sequence of pLKO.1 TRC-Cloning Vector...marker encoded in pLKO.1 allows for convenient stable selection. Figure 1 : Map of pLKO.1 containing an shRNA...puromycin should be from 1-10 μg/mL in 1 μg/mL increments. d. Label plates from 1-10 and add appropriate...Appendix I.1. Sequence of pLKO.1 TRC-Cloning Vector Click here to see the sequence of pLKO.1 TRC-cloning...convenience. See “warranty information” in appendix. Table of Contents A. pLKO.1-TRC Cloning Vector A.1 The RNAi...

...ratios of 1:1, 1:2, 1:3 and 1:6. The 1:2 and 1:3 total DNA:PEI μg ratios provided high transfection efficiencies...possible range of ratios to test: Ratio of DNA:PEI μg of DNA μL of 1 mg/mL PEI 1:1 18.9 18.9 1:2 18.9 37.8... 37.8 1:3 18.9 56.7 1:4 18.9 75.6 1:5 18.9 94.5 1:6 18.9 113.4 Gently add the diluted PEI mixture to the...: Monday: Plate 1×10 6 cells in a T75 flask in 15 mL DMEM Complete. Wednesday: Plate 1×10 6 cells in a...packaging cells Day 1 (pm): Transfect packaging cells Day 2 (am): 18 h post-transfection. Remove media, replace...ratio of μg DNA:μg PEI is 1:3 (1000 μL total per 10 cm dish). Using transfer plasmid pHAGE TRE dCas9-KRAB...prepared, transfect cells with a fluorescent plasmid using a variety of ratios. Check the cells 1-2 days ...

...Dilution 1:10 100 of Stock Virus 900 150 1,350 1:100 1:100 100 of 1:10 900 150 1,350 1:1,000 1:1,000 100...100 of 1:100 900 150 1,350 1:10,000 1:10,000 100 of 1:1,000 900 150 1,350 1:100,000 1:100,000 100 of 1... 1:10,000 900 150 1,350 1:1,000,000 Mix the dilutions well Note: the 1:10 dilution can usually be omitted...with 1 mL of 0.1% crystal violet for 10 min at RT. Gently remove the stain. Wash cells 3x with 1 mL of...multiple dilutions. Sample Data Figure 1: A549 cells were transduced with the indicated serial dilutions ... media from the wells. Gently wash the cells with 1 mL of PBS and aspirate wash. Filter 0.1% crystal violet...volume in the well (mL) x dilution factor e.g., If the 1:100,000 well has 75 colonies, then there are 75 colonies...

... Proceed with transfection: Calculate the amount of each plasmid needed to have a 1:1:1 molar ratio with...7.5% Sodium Bicarbonate, 7.5 mL 1 M HEPES to 750 mL DMEM + 1 g/L glucose. 1 mg/mL polyethylenimine (PEI) ... determine the total μg/bp we need to achieve a 1:1:1 molar ratio of each plasmid: 2000 μg / 24,961 bp...deionized water + 100 mL of 1 M Tris HCl pH 8.5 + 60 mL of 5 M Sodium Chloride + 4 mL of 1 M Magnesium Chloride... adherent cells) 1 mg/mL Polyethylenimine (PEI) 25 kDa MW Pro-Tip Other transfection reagents may be used...high glucose, Corning 10-013-CV DMEM, low glucose (1 g/L) glucose, sodium pyruvate, Corning 10-014-CV (... sodium bicarbonate, Corning 25-035-CI (optional) 1 M HEPES, HyClone SH30237.01 (optional) L-alanyl-L-glutamine...

...Dilution 1 (20X): 5 µL in 95 µL 1X PCR buffer (1:20) Dilution 2 (20X): 5 µL in 95 µL 1X PCR buffer (1:400)...95 10 2 1 Denaturation 95 0.5 2 50 Annealing/Extension 60 1 2 50 Signal Stabilization 98 10 2 1 Hold 4 ...Use a single channel 1–10 µL pipette to add 5 µL of each viral sample to Dilution 1 in the 48-well dilution... 95 µL 1X PCR buffer (1:8,000) Dilution 4 (20X): 5 µL in 95 µL 1X PCR buffer (1:160,000) Dilution 5 (20X...95 µL 1X PCR buffer (1:3,200,000) Dilution 6 (2X): 50 µL in 50 µL 1X PCR buffer (1:6,400,000) Dilution ...50 µL 1X PCR buffer (1:12,800,000) Dilution 8 (2X): 50 µL in 50 µL 1X PCR buffer (1:25,600,000) Use multichannel...pipettes for the dilution series. For dilutions 1–5, use the 1–10 µL multichannel pipette set to 5 µL. For...

...tissues: use 1 mL of Solution D per 100 mg of cells. For cultured cells: use 1 mL of Solution D per 1 X 10 7...tissues: use 1 mL of TRIzol® per 100 mg of cells. For cultured cells: use 1 mL of TRIzol® per 1 X 10 7 cells...Option A): Add 1 volume of Isopropanol to the extracted aqueous layer. Incubate at -20°C for 1 hour. Lithium.... Add 0.2 mL of Chloroform/Isoamyl alcohol (49:1) per 1 mL of TRIzol® used. Shake vigorously by hand for... sample(s).Transfer tissue/cell lysate to a 4 mL tube. Add the following sequentially to 1 mL of lysate... User Guide from ThermoFisher Scientific . Figure 1: A diagram of the different steps in RNA extraction...

...polybrene (μL) 1:10 150 1348.5 1.5 1:25 60 1438.5 1.5 1:50 30 1468.5 1.5 1:75 20 1478.5 1.5 1:100 15 1483.5...Factor V T = Transduction Volume, mL For example: If 150,000 cells were transduced in the 1:100 well, resulting...dilutions. Sample Data Figure 1: 293T cells were transduced with a range of dilutions of pHAGE-TO-dCas9...Workflow Timeline Day 0: Seed 293T cells Day 1: Transduce cells Day 2 (am): Remove media, replace with...Calculate the transduction units per mL (TU/mL) using either the dilution factors (method 1) or the volume...Method 1 Method 2 $$T = {N*F*D\over V_T}$$ Where: T = Titer, TU/mL N = Number of cells transduced F = Fraction...for 48–72 h. Gently aspirate media and replace with 1 mL of PBS. Calculate the fraction of fluorescent-positive...

...NaH 2 PO 4 ∙H 2 O 1 L deionized water Adjust pH to 7.0 Autoclave or filter sterilize 1 M sodium phosphate...NaH 2 PO 4 ∙H 2 O 1 L deionized water Adjust pH to 7.0 Autoclave or filter sterilize 1 M of sodium phosphate...protease inhibitor cocktail. Add 1 part Protein A/G binding buffer to 1 part tissue culture supernatant...Choose Option 1 or Option 2 based on the concentration of the pooled sample above. Option 1: Buffer exchange...antibody to 1 mg/mL with PBS if needed. For long term storage, add sterile sodium azide to 1 mM. Option...purify recombinant antibodies. Workflow Timeline Day 1: Purify antibody Day 2 or later: Buffer exchange Equipment...°C bead bath Clamp stand and clamps Autoclave 0.1–1 mL single channel pipette 0.5–10 µL single channel...

...dilution Dilution 1 (DNase step) 5 uL AAV stock 45 uL 10X 10X Dilution 2 5 uL Dil. 1 95 uL 20X 200X Dilution...reference virus that is 1 x 10 13 GC/mL. We recommend always using a reference within 1-log of the expected...DNase buffer + 1 μL DNase Gently mix sample (do not vortex) Incubate 30 min at 37 °C Transfer to ice ** Critical...dilutions 5–8 Note: at Addgene, samples typically range from 1 x 10 12 GC/mL to >2 x 10 13 GC/mL and we use...Equipment qPCR instrument Heating plate Pipettors 1–10 µL single channel pipette 20–200 µL single channel...channel pipette 200–1000 µL single channel pipette 1–10 µL multichannel pipette 2–50 µL multichannel pipette...The reference material should have a titer within 1-log of the expected titer of the samples being tested...

...95 10 2 1 Denaturation 94 0.5 2 40 Annealing/Extension 60 1 2 40 Enzyme Deactivation 98 10 2 1 Hold 4 ... primers/probe (FAM) 1 µL 9 µL 900 nM, 250 nM 20X RPP30 primers/probe (HEX/VIC) 1 µL 9 µL 900 nM, 250 ...Update: July 7, 2023 Workflow Timeline Day 1: Seed and transduce cells Day 4: Treat cells with Benzonase ...a well of a 6-well plate (1 dilution per well). Leave one well untransduced (add 150 µL of DMEM complete...with 200 µL TrypLE for 1–2 min. Resuspend cells in 500 µL DMEM complete and transfer to a microcentrifuge...4 ∞ 2 1 After PCR is complete, transfer the plate to the Droplet Reader. Open the QuantaSoft software ...14440 24260 1.190436933 5.95E+06 7.29E+06 7 Untransduced 1 6.4 17940 0.0007134894091 1.43E+02 Table: Example...

...mL polybrene (µL) 0 0 500 1:5 300 200 1:10 150 350 1:50 30 470 1:100 15 485 1:500 3 497 Add 0.5 mL of a... if an MOI >1 was used, some cells may have 1 copy of the transgene, while others have >1 copy of the ... Cas9. A549 cells were transduced with lentiCas9-Blast and then selected with 1 µg/mL blasticidin for... well by pipetting or inverting the tube. Aliquot 1 mL of cell suspension (i.e., 50,000 cells) into each... early polyclonal populations. Sample Data Figure 1: Generation of monoclonal cell lines from expansion...Different brands and FBS lots can promote or inhibit transfection. Test a variety of brands and FBS lot...-term protein expression observed using transient transfection approaches, generating cell lines using...

...June 14, 2023 Workflow Timeline Day 1: Run SDS-PAGE and stain gel Day 1 or later: Image analysis Video Watch...lane Example for AR0018 (lane 2 in Figure 1): Sample Peak 1 (contaminant) Peak 2 (contaminant) Peak 3 ...antibodies using Coomassie stain. Equipment Heat block 1–10 µL single channel pipette 2–20 µL single channel...deionized water. Gently invert to mix. Procedure Section 1: SDS-PAGE Add 5 µL of 4X sample buffer to each sample...attach to a power supply. Run the gel at 150 V for 1 h . Pro-Tip If the samples are running unevenly and...Add 20 mL of SimplyBlue SafeStain and incubate for 1 h with gentle agitation on a rocking platform. Pour...sink. Add 100 mL of deionized water and incubate for 1 h with gentle agitation on a rocking platform. Pour...

...cells transduced with lentiCas9-Blast 1 . A549 cells were transduced (MOI = 37) and selected with 1 μg/mL...Cas9. A549 cells were transduced with lentiCas9-Blast 1 and then selected with 1 μg/mL blasticidin for...Because this is such a small volume, first make 1 mL of a 1:100 dilution of the homogenized cell solution... solution, transfer 12.5 µL of the 1:100 dilution to 10 mL of conditioned medium. Transfer 100 µL of the... the highest or lowest transgene expression ( Figure 2 ). Sample Data Figure 1: Generation of monoclonal...conditioned medium (see below for more details) Day 1: Seed individual cells in a 96-well plate Day 2–14...cells will appear as colonies in the well ( Figure 1 ). You will be able to tell if there was more than...

...Vented Falcon Tubes at 30-37 ℃, 225 rpm for 1 hour. After the 1 hour shaking period, pool and gently mix ...Timeline Day 1: Transform, recover, set up overnight growth (Estimated time 2-3 hours) Transformation should... (Default: 4 tubes of Endura Duos, Lucigen, 60242-1) Alternatives include Stbl4 cells or other ultra-high...0.1 cm ) 20 mL SOC recovery media (Lucigen, 80026-1) 8X LB Agar + Antibiotic 245 mm bioassay plates (Molecular...into each of four 14 mL Vented Falcon Tubes and have 1 mL SOC per electroporation readily available for post-electroporation...autoclaved, sterile reagents for all steps. Procedure Day 1 Add 200 ng DNA to each 50 µL aliquot of thawed Endura...: Bio-Rad Micropulser Ec1 0.1 cm cuvette, 1.8 kV, 1 pulse. Aliquot 25 µL DNA-Endura into pre-chilled cuvette...

...DNA 10-50 ng/μl 1 dGTP (100mM) 2.5 mM 2 DTT (100 mM) 5 mM 1 BSA (10 μg/μl) 0.25 μg/μl 1 T4 DNA polymerase...6: Anneal and Transform Mix your treated vector and insert at a molar ratio of 1:2 or 1:3, using between...now ready for transformation. Use 1-2 μl of annealing reaction for each transformation, following a standard...collection of empty LIC cloning vectors Protocol Step 1: Design Your Primers Primer design for LIC is often...reaction for 5 minutes at room temperature, then add 1 μl of 25 mM EDTA, followed by another 5 minutes at...stability to hold the plasmid together through the transformation/replication process. LIC employs long overhangs...association between fragments, allowing for transformation without ligation. Because of its dual polymerase...

...avoid breathing in the vapors. Workflow Timeline Day 1: Antigen Coating Day 2: Blocking Day 3: Primary antibody... Spectrophotometer compatible with 96-well plates 1–10 µL single channel pipette 2–20 µL single channel... µL, VWR 76322-134 Pipettes, 10 mL, VWR 89130-898 1 L polystyrene bottle, Corning 430518 PBS, 1X pH 7.4...Warm reagents to room temperature. Procedure Section 1: Prepare the Antigen Standard and coat the plate Dilute...stock into 900 µL PBS in a microfuge tube and vortex. 1 ng/µL : Add 450 µL of 2 ng/µL stock into 450 uL PBS...microfuge tube and vortex. 0.5 ng/µL : Add 450 µL of 1 ng/µL stock into 450 µL PBS in a microfuge tube and... a microplate shaker set at 400 rpm and shake for 1 min . Repeat steps 8–10 twice for a total of three...

...chemiluminescence substrate by mixing 1:1 reagent A to reagent B. Gently incubate the membrane in the chemiluminescence...Block the membrane in blocking buffer for 1 h at RT on a shaking platform. Wash the membrane 3x for 5 ...24, 2022 Workflow Timeline Day 1: Prepare lysates, run SDS-PAGE, transfer, block, incubate with primary...supernatant. Resuspend cell pellet in 1 mL of 1X PBS and transfer to a microcentrifuge tube. Centrifuge...antibodies but is typically between 1–10 μg/mL. Incubate the membrane overnight in primary antibody at 4...antibodies but is typically between 1–10 μg/mL. Incubate the membrane with secondary antibody for 60 min...primary antibodies raised in a mouse. Procedure Section 1: Lyse cells Centrifuge 5 x 10 6 cells for 5 min at...

... resistance) Procedure Day 1 Prepare carbenicillin to a concentration of 1 mg/mL – 4 mg/mL in LB medium... than the 1 mg/mL and 2 mg/mL plates and effective selection. Selection Curve of Transformed E. coli after...lawn of E. coli and no apparent selection. 150 µL of 1 mg/mL Carbenicillin plated over-agar Plate shows several...over-agar Plate shows less individual colonies than the 1 mg/mL plate and effective selection. 150 µL of 4 mg...incubation, transform DH5α E. coli cells by heatshock with the plasmid of interest. See our transformation page...for a detailed heatshock transformation protocol. Plate 50 µL of transformed E. coli /rescue media suspension...also like... Making LB Agar Plates Bacterial Transformation Recovering Plasmid DNA from Bacterial Culture...

...(PPE) for BSL-1 and BSL-2 Labs Learn how to best protect yourself when working in BSL-1 and BSL-2 labs...Levels One and Two (BSL-1 and BSL-2) Safety measures for laboratories operating at BSL-1 and BSL-2 Watch the... T4 polymerase pLKO.1 - TRC Cloning Vector Cloning protocols for using the pLKO.1 vector, a backbone used...practical lab protocols that you can use for a wide range of applications, with videos for select protocols...Ligation Assemble DNA using DNA ligase Bacterial Transformation Introduce DNA into a bacterial strain Watch...preparations. Name Description Link to Video General Transfection Introduce plasmid DNA to mammalian cells Lentivirus...Produce lentivirus with a polyethyenimine (PEI) transfection protocol Fluorescence Titering Assay for Lentivirus...

...annealing temperature step-wise by 1-2°C. The rate of DNA synthesis is ~1-2 kb/min. The extension time can...now bind to the primer DNA sequence. Extend DNA for 1 minute at 72°C: The Taq polymerase has an optimal ...DNA (10 ng-500 ng) 5 μl 10X Taq buffer with MgCl 2 1 μl dNTP mix (10 mM each nt) 2.5 μL Forward Primer ...primer melting temperature (Tm). Set extension step at 1-2 minutes per kilobase of product depending on whether...working concentration of each primer (10uM) by making a 1:10 dilution of the stock. For example, add 100µl of...step heats the double stranded DNA template strand to the point where the strands start denaturing and ...

...restriction digestion reaction could look like this: 1 µg DNA 1 µL of each Restriction Enzyme 3 µL 10x Buffer...definition: one unit of enzyme will cut 1 µg of DNA in a 50 µL reaction in 1 hour. Using this ratio, you can ..., incubation time can range from 45 mins to overnight. For diagnostic digests, 1-2 hours is often sufficient...ng of DNA, while molecular cloning often requires 1 µg of DNA. The total reaction volume usually varies...tube at appropriate temperature (usually 37 °C) for 1 hour. Always follow the manufacturer’s instructions...sufficient. For digests with >1 µg of DNA used for cloning, it is recommended that you digest for at least...

...Preparation 1 M NaCl/PBS-MK buffer Dissolve 5.84 g of NaCl, 26.3 mg of MgCl 2 and 14.91 mg of KCl in 1× PBS ...gradient for AAV purification. Workflow Timeline Day 1: Purify Day 2: Buffer exchange and concentration Note...Dissolve 26.3 mg of MgCl 2 , and 14.91 mg of KCl in 1× PBS in a final volume of 100 mL. Sterilize by passing... step: mix 4.5 mL of 60% iodixanol and 13.5 mL of 1 M NaCl/PBS-MK buffer 25% iodixanol step: mix 5 mL ...Hamilton needle, taking care to avoid bubbles (Figure 1). 8 mL of 15% iodixanol step 5 mL of 25% iodixanol...disturb the gradient!** Collect Fractions Option #1 Prepare a row of roughly 20 open 1.5 mL microcentrifuge...with a 16 ga needle and start collecting 0.5 mL to 1 mL fractions per tube. Avoid the proteinaceous material...

...antibody concentration will vary but generally ranges from 1-10 µg/mL. Add 500 µL of the diluted antibody...antibody concentration will vary but generally ranges from 1-10 µg/mL. Add 500 µL fluorescently-labeled secondary...Last Update: January 20, 2022 Workflow Timeline Day 1: Seed cells Day 3-4: Fix and label cells Equipment...into 5 mL PBS. Protect from light. Procedure Section 1: Seeding cells Place a sterile poly-D-lysine coated...with a laboratory wipe to remove excess liquid. Add 1 drop of anti-fade mounting medium to the microscope... Inclusion of this information is solely for transparency intended to support reproducibility in science...you know expresses the protein, such as cells transfected with a plasmid to express the protein of interest...