... CMV immediate early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter...end of LexA DNA binding domain, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter... MT1-F GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter, forward primer mU6-F CAGCACAAAAGGAAACTCACC...end of Drosophila mini-white gene, reverse primer pCasper-hs GCAACTACTGAAATCTGCCAAG Drosophila Hsp70 promoter... primer AC5 ACACAAAGCCGCTCCATCAG (Invitrogen) Drosophila Actin 5C promoter, forward primer Alpha-factor...Forward CTCTGAATACTTTCAACAAGTTAC (Invitrogen) Drosophila heat shock promoter, forward primer EF-1a Forward...primer MT Forward CATCTCAGTGCAACTAAA (Invitrogen) Drosophila metallothionein promoter, forward primer MMLV-F...

...64325 3xFLAG-dCas9/p-bacteria 3xFLAG-dCas9 pLtetO-1 Fujii Efficient isolation of specific genomic regions...gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR...

...annealing temperature step-wise by 1-2°C. The rate of DNA synthesis is ~1-2 kb/min. The extension time can...now bind to the primer DNA sequence. Extend DNA for 1 minute at 72°C: The Taq polymerase has an optimal ...DNA (10 ng-500 ng) 5 μl 10X Taq buffer with MgCl 2 1 μl dNTP mix (10 mM each nt) 2.5 μL Forward Primer ...primer melting temperature (Tm). Set extension step at 1-2 minutes per kilobase of product depending on whether...working concentration of each primer (10uM) by making a 1:10 dilution of the stock. For example, add 100µl of... of a heat resistant DNA polymerase from the thermophilic bacterium, Thermus aquaticus (Taq) . Taq polymerase...

...infection, gene targeting vectors with relatively short (1 kb) homology arms underwent homologous recombination...sequences of interest to cells with efficiencies of 1-40% after G418 selection (Kohli et al 2004, Kim et...with polylinkers for the addition of gene-specific 1 kb homology arms flanking a FLOXed neoR gene. pAAV-SEPT-Acceptor...since it routinely generates knockin efficiencies of 1-40% with G418-selected clones. However, there are ...efficiency of gene editing is occasionally less than 1%, and virtually never exceeds 40%. While this is comparable...gene inactivation in human cancer.     References 1. Russell, David W., and Roll K. Hirata. "Human gene...zygotes and thereby correct a mutation that causes Hemophilia B. Unfortunately, work combining CRISPR with ...

...incorporates several common genetic tools in Drosophila (Fig. 1):  GAL4-UAS, a transcription factor binding...Rodríguez et al., 2011).  Genetics of SPARC Figure 1: SPARC and SPARC2 use the GAL4-UAS system along with.... So far, tools to overcome this challenge in Drosophila require heat-shocking the system or using chemical...techniques to reliably label any post-mitotic cells in Drosophila. SPARC was developed by Thomas Clandinin’s lab...recombination sites. These sites are target sequences of PhiC31. In the SPARC system, attP sites are located on...is not expressed and the cells are not labeled. PhiC31, a recombinase. It specifically integrates an attP...attP site into an attB site. In the SPARC system, PhiC31 irreversibly recombines one of the two competing...

...a rate of up to 1 per 500-1000 bp. In comparison, the DNA replication error rate is 1 per 109 bp. Unlike...Transcriptional Output-TANGO (PRESTO-TANGO) to screen the NCC-1 library of approved drugs against the entire kit; ...generated 5 common 30bp overlap sequences (Sites #1-5). Each overlap site encodes a unique restriction...First, GMAP-compatible backbones for lentivirus LV 1-5 and retrovirus RV 2-5 were constructed. The authors...is multiplex automated genome engineering (MAGE) (1). MAGE uses recombineering (2) to simultaneously incorporate...of GFP (SEP) by a 9 amino-acid linker (see Figure 1). The key to the biosensor lies in pH: DsRed is relatively...inactivate SEP and leave only DsRed to fluoresce (1). With variants that can be targeted to specific cellular...

...production of the pro-inflammatory cytokine interleukin IL-1 beta in the dorsal raphe nucleus (DRN), a region thought... a transgenic mouse harbouring a Cre-dependent IL-1 beta overexpression cassette. Expression of Cre in...in these neurons turns on overexpression of IL-1 beta. They tested the mice in a series of behavioral ...risky), or a closed arm (safe). Mice with higher IL-1 beta production spent more time in the open arm and... part of the apparatus, it turned out that the IL-1 beta overexpressing mice spent more time in the risky... addiction. When an animal has been exposed to morphine or other stimulating drugs, it develops an enhanced... such genetic study focuses on brain derived neurotrophic factor (BDNF). BDNF is a small protein involved...

... chromosome, start, and stop. For instance (chr3, 1, 10) indicates a stretch of DNA at the very beginning...genetic elements like protein, RNA, and DNA (Table 1). As with GPS in the real world, coordinates alone...genomic coordinates into meaningful experiments. Table 1: An emerging family of "GPS for the genome" techniques...enhancers with the help of genome math. Figure 1: Genome math illustrated. Intersect (left) and set...histones with “GPS for proteins,” ChIP-seq from Table 1. Because of DNA’s 3D geometry and the chemical properties...experiment to identify the critical NANOG binding sites: 1. Find Enhancers that have NANOG binding sites 2. Design... In order to denote the NANOG enhancers from step 1 with genome math, we’ll need a bit of shorthand from...

...but also others including pseudorabies virus type 1, vesicular stomatitis virus (VSV; Beier et al., 2011...Skeletal Muscle AAV1, AAV6, AAV7, AAV8, AAV9 Table 1: Common AAV Serotypes and their target tissues (adapted... serotypes capable of entering neurons (see table 1)(Choi et al., 2005; Taymans et al., 2007; Howard et...efficiency, tropism and axonal transport of AAV serotypes 1, 2, 5, 6, 8 and 9 in the mouse brain. PLoS One 8:e76310...Wolfe, J.H. (2014). Adeno-associated virus serotypes 1, 8 and 9 share conserved mechanisms for anterograde...,9 in rat neurons and glia in vitro. Virology 372(1), 24–34. PubMed PMID: 18035387. PubMed Central PMCID...transduction efficiency of recombinant AAV serotypes 1, 2, 5 and 8 in the rat nigrostriatal system. J Neurochem...

...PDF 2.3 MB Zhang GeCKO pooled library amplification 1 vector system: lentiCRISPR v2 2 vector system: lentiCas9...putative target sites for S. pyogenes Cas9, S. thermophilus Cas9, or Cpf from your input sequence or list...checks for off-target binding. Currently supports: Drosophila, Arabidopsis, zebrafish, C. elegans, mouse, human...tropicalis and X. laevis), zebrafish, sea squirt, Drosophila, C. elegans, Arabidopsis, rice, sorghum, silkworm...checks for off-target binding. Currently supports: Drosophila, Arabidopsis, zebrafish, C. elegans , mouse, ...off-target binding and can work for S. pyogenes, S. thermophilus or N. meningitidis Cas9 PAMs. Currently supports...

...was around 33% of that observed between Jan. 1 and Mar. 1, 2020. Figure 2: A simple approximation...paper. Green and red lines depict the sum of mean +1 and -1 std for each paper, respectively. The fitted...complication in the China data – there is a period of 1 month, from 1/22/20–2/23/20, where there were zero plasmid... from 5/22/14 to 5/19/20). Each paper has between 1–32 plasmids and a total of 2–2,590 requests. We received...correspond to publications of popular papers. Figure 1: Plasmid requests by date. Parentheses depict the ...China. However, it is evident that if we believe that 1/22/20–2/23/20 are the more accurate dates of lockdown...effect on plasmid requests Before we began any sophisticated analyses, we first visualized our data in various...

...difficult-to-manipulate primary cells, achieving knockdown within 1-2 hr of reagent delivery. TRIM-Away is suitable for... inducer levels. That is, if transcription factor 1 controls expression of transcription factor 2, which...modulating the induction of transcription factors 1 and 2. See Aranda-Díaz et al. for more information... from his recent Nature Communications article “SRpHi ratiometric pH biosensors for super-resolution microscopy... designed their super-resolution pH indicators (SRpHi) biosensors to meet all of them. These probes had...contributed a relevant post to the Addgene blog. Find the SRpHi Biosensors here. Richardson et al. Nat Communications...

...within the mitochondrial matrix.     Figure 1: A chart with MoClo kit recommendations for different...Traditional Biology.” ACS Synthetic Biology, vol. 5, no. 1, American Chemical Society (ACS), 4 Nov. 2015, pp...., vol. 4, no. 9, American Chemical Society (ACS), 1 May 2015, pp. 975–86. Crossref, https://doi.org/10.1021...Yeast Mitochondria.” BMC Biotechnology, vol. 17, no. 1, Springer Science and Business Media LLC, 13 Nov. ...Editing in Plants.” BMC Plant Biology, vol. 20, no. 1, Springer Science and Business Media LLC, 23 Apr. ...Arabidopsis Mutants.” The Plant Journal, vol. 106, no. 1, Wiley, 25 Mar. 2021, pp. 8–22. Crossref, https://...Cloning Platform.” Scientific Reports, vol. 9, no. 1, Springer Science and Business Media LLC, 12 July ...

...aggregation, and potentiates the effect of PD-1 blockade.“ (Ref 4). PD-1 helps tumor cells evade the immune system...fasting has a positive effect on cancer treatment (Ref 1). As described in the presentation, starvation or ...of the immunosuppressive cell surface receptor PD-1. This immunosuppressive environment in turn may represent...  (Chimeric Antigen Receptors) CAR T cells and PD-1 modulators. An exciting development in immunotherapy...free deposit and distribution service! References: 1. Pietrocola, Federico, et al. "Caloric restriction...Immunosurveillance and Defense With increasingly sophisticated visualization techniques it is possible to follow...

...effective recovery of knock-ins, but did result in 1-2 kilobases of additional sequence being introduced...facilitating recovery of edited animals. Figure 1: In the background are 504 restriction digests of ...selection for repair of a temperature-sensitive pha-1 mutation significantly enriches for knock-in of 2x... 3xFLAG epitopes into other, non-linked loci; pha-1(e2123) mutant worms are perfectly viable at 15 ºC,... repair pathway. Reagents required to perform pha-1 co-conversion are available through Addgene. In 2019...increases knock-in efficiency. Finally, as shown in Drosophila S2 cells (Böttcher et al., 2014), inactivation... Hollmann M, Merk K, Nitschko V, Obermaier C, Philippou-Massier J, Wieland I, Gaul U, Forstemann K (2014...

...Hyg Chen 86196 pYPQ141-ZmUbi-RZ-As Maize ubiquitin 1 none As Cpf1 Qi 91715 pKEE401 yes, cut S. pyogenes...gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR...

...HIV-1 were transduced with a lentiviral vector containing an antisense sequence against the HIV-1 envelope... in the brain (Figure 1). 2nd generation lentiviral packaging system The graphic below shows how the lentiviral...Trono and collaborators turned to the lentivirus HIV-1, well-known to infect non-dividing cells. The first...plasmids. The packaging plasmid carried a mutated HIV-1 provirus that couldn’t package itself due to a few...plasmid encoded the desired transgene flanked by HIV-1 long terminal repeats (LTRs) that facilitate viral...infectivity, is often used as a substitute for HIV-1 Env, which can only infect CD4+ cells. 3rd generation...lentivirus in the comments section below! References 1. In vivo gene delivery and stable transduction of ...

...and Therapeutic Purposes. Annu Rev Virol. 2014 Nov;1(1):427-51. DOI: 10.1146/annurev-virology-031413-085355...personalized medicine. References and further reading 1. FDA approves gene therapy for blindness 2. Gene Therapy... Med Biol. 2014; 801: 687–693.  doi:  10.1007/978-1-4614-3209-8_86. PubMed PMID: 24664759. PubMed Central...prevalent or life-threatening (cystic fibrosis, hemophilia, muscular dystrophy)? AAV gene therapy started...trials for devastating genetic diseases such as hemophilia, muscular dystrophy, spinal muscular atrophy,...

... most popular genome engineering approach. Figure 1: Overview of the basic CRISPR mechanism Engineered...from Staphylococcus aureus ) has a coding sequence ~1 kb shorter than SpCas9 while retaining the same basic...lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9 is included in the gRNA-containing...efficiency and fidelity. Nature Communications , 13 (1), 1425. PMID: 35301321 Edraki, A., Mir, A., Ibraheim...interrogation by SpRY-Cas9. Nature Communications , 15 (1), 3663. PMID: 38688943 Hsu, P. D., Scott, D. A., Weinstein...increase its specificity. Nature Communications , 9 (1). PMID: 30082838 Maddalo, D., Manchado, E., Concepcion...CRISPR-Cas9 with Bacteriophage Proteins. Cell , 168 (1–2), 150-158.e10. PMID: 28041849 Sakuma, T., Nishikawa...

...one of three different inherited genes: Presenilin 1, Presenilin 2, and APP gene.The majority (>90%) of...collections available at Addgene. Amyotrophic Lateral Sclerosis Amyotrophic lateral sclerosis (ALS), sometimes...

...minutes, which was fun to watch. A simpler 1 protein - 1 RNA system Drs. Dounda and Charpentier met at...to direct cleavage the result was a simpler 1 protein - 1 RNA system.  Dr. Charpentier advocated for the...for billions of years (…) Bacteria are really sophisticated”.     New to CRISPR/Cas9 Technology? Learn ...

...backbones for shRNA expression, such as pLKO.1 puro and pLKO.1 – TRC cloning vector. Lentiviral Plasmids ... 10 years of plasmid sharing? Check out this infographic created by our own Addgenie, Laura Veckerelli...Veckerelli. Click on the picture below to see the full graphic.        ...

... employing HDR. Ma et al. moved forward with gRNA 1 to conduct microinjection experiments in S phase zygotes...instead from the mother’s wild type allele (Figure 1). 72.4% of embryos carried two wild-type copies of...proceeded through NHEJ rather than HDR. Figure 1: Homology-directed repair in targeted zygotes proceeds...autosomal dominant mutation in MYBPC3 that leads to hypertrophic cardiomyopathy. An adult male with a heterozygous...applicable in many situations. In the case of hypertrophic cardiomyopathy and other genetic disorders, ...

...lentiviral transfer plasmids are based on the HIV-1 virus. For safety reasons, transfer plasmids are all...shRNA‐expressing lentiviral plasmids, such as pLKO.1, use a U6 or H1 promoter in order to drive RNA pol...protocol for using the popular cloning vector pLKO.1. Trono Lab Resources: Lentivectors Toolbox and Maps...selection. Desfarges S, Ciuffi A. Viruses. 2010. Jan;2(1):111-30. PubMed . Altering the tropism of lentiviral...Curr Gene Ther. 2005. 5(4): 387-398. PubMed . HIV-1 Genome Nuclear Import Is Mediated by a Central DNA...plasmids available from Addgene. 2nd Generation The graphic to the right shows how the lentiviral genome is...

...near-perfect physical-to-infectious particle ratio of 1:1 (Zeltner et al., 2010). However, for recombinant ...preparations are genome-containing (Figure 1).    Figure 1: Electron micrograph of an Addgene AAV...reported a physical-to-infectious particle ratio of 50:1 (Zeltner et al., 2010). The specific infectivity of... lot (if we still have it available). References 1. Fagone, Paolo, et al. "Systemic errors in quantitative... Human Gene Therapy, Part B: Methods 23.1 (2011): 1-7. PubMed PMID: 22428975. PubMed Central PMCID: PMC3640491...Image courtesy of David Bell and Svetla Stoilova-McPhie, Center for Nanoscale Systems, Harvard University...

... requires selection. These two steps are (Figure 1): The initial plasmid integration step (the so-called...antibiotic resistance marker from the vector (abR, Figure 1). The resolution step (“double crossover”) which leads... loss of a specific phenotype (using sacB, Figure 1, further discussed below).  Counter-selectable marker...Current protocols in molecular biology 106.1 (2014): 1-16. PubMed PMID: 24733238. Additional resources on...performed the following modifications to pDS132 (Philippe et al., 2004): Replaced the sacB cassette with...PMID: 29760772. PubMed Central PMCID: PMC5946454. Philippe, Nadège, et al. "Improvement of pCVD442, a suicide...

... handed out at the event). Program 0 - 1:24 - Intro 1:24 - 29:31 - Reproducibility Overview - Jeffrey... 49:45 0 1:18:45 - Reagent Development - Steven C. Almo, Institute for Protein Innovation  1:18:45 - 2...reproducibility As Jeffrey Flier points out in his talk (1:24 - 29:31), there are a variety of ways of defining...enterprise towards greater reproducibility. Cause 1: Inability to repeat previously performed experiments...the Institute for Protein Innovation (IPI) (49:45 - 1:18:45), there are also initiatives to create more ...found. Consider the hypothetical situation in Figure 1 where many scientists are performing similar experiments...Editor at Science) Edward J. Hall (Professor of Philosophy at Harvard University) Tony Cijsouw (Neuroscience...

...algae Chlamydomonas reinhardtii . Channelrhodopsin-1 (ChR1) is excited by blue light and permits nonspecific...based on the LOV2 domain of Avena sativa phototropin 1 LOVETRAP reversibly sequester and release proteins...concept of optogenetics. 2012 Prog Brain Res. 196: 1-28. PMID 22341318 Gradinaru V, Zhang F, Ramakrishnan...diversifying and extending optogenetics. Cell. 196:1-28. PMID 20303157 Han X, Boyden ES. 2007 Multiple-...Limitations and Future Developments. Exp Physiol. 96(1): 19–25. PMID 20621963 Mattis J, Tye KM, Ferenczi ... in model organisms like mice, zebrafish, and Drosophila. These tools have been instrumental in neurological...

...Invitrogen F- Phi80lacZDeltaM15 Delta(lacZYA-argF) U169 recA1 endA1 hsdR17(rk-, mk+) phoA supE44 thi-1 gyrA96...) xyl-5 λ– leu mtl-1 Top10 Invitrogen F- mcrA Delta(mrr-hsdRMS-mcrBC) Phi80lacZM15 Delta-lacX74 recA1 ...Addgene; Promega e14-(McrA-) recA1 endA1 gyrA96 thi-1 hsdR17(rK- mK+) supE44 relA1 Delta(lac- proAB) [F ...use, dilute your antibiotic into your LB medium at 1:1,000. For example, to make 100 mL of LB/ampicillin...Invitrogen F- mcrA Delta(mrr-hsdRMS-mcrBC) Phi80lacZDeltaM15 Delta-lacX74 recA1 araDelta139 D(ara-leu)7697...

...harness non-homologous end joining repair (NHEJ) [1]. Our initial work was with TALENs, in collaboration...from the University of Pennsylvania.     References: 1. Lee HJ, Kim E, Kim JS. Targeted chromosomal deletions...using zinc finger nucleases. Genome Res. 2010 Jan;20(1):81-89. PubMed. 2. Bauer DE, Kamran SC, Lessard S,...these may require restriction fragment length polymorphism analysis, allele-specific PCR, T7EN1 cleavage...

... fusions that retain their individual activities (1). Researchers also discovered the modular format of...systems could be combined effectively (3). In Figure 1 for instance, the DBD of the fusion protein shown ...ubiquitin system has been devised (8). References 1. Casadaban M.J., Martinez-Arias A., Shapira S.K., ...now many variations, including many that use auxotrophic rescue genes as reporters and some that repress...example of the former. In this system, histidine-auxotrophic host strains are used to select for binding-dependent...

...is expanding rapidly.  References 1. Kunjapur, Aditya M., Philipp Pfingstag, and Neil C. Thompson. "Gene...from distantly related organisms. In 2006, less than 1% of the genes deposited at Addgene were synthetic.... student at the time, got involved. Along with Philipp Pfingstag, a visiting graduate student from TU ...

...NgAgo takes a different approach, randomly removing 1-20 nucleotides from the cleavage site specified by...About NgAgo User's First Impressions Here References 1. Gao, Feng, Xiao Z. Shen, Feng Jiang, Yongqiang Wu... et al. characterized Argonaute from Thermus thermophilus (TtAgo), showing that this protein could cleave...orthologs similar to TtAgo and PfAgo, another thermophilic Argonaute. They identified NgAgo and showed ...

...phosphorylated DNA termini to 3 ́-OH DNA termini (1-4). In vitro, ligases (notably T4 DNA ligase) are ... enzymology of DNA repair enzymes.     References 1. Shuman, Stewart, and Christopher D. Lima. "The polynucleotide...thermostable DNA ligase-encoding gene." Gene 109.1 (1991): 1-11. PubMed PMID: 1756968. 7. Lauer, G., et al. "Cloning...and even include profiling single nucleotide polymorphisms (SNPs) (5,12,13). For example, in the Ligase...sequence, and engineered expression of Thermus thermophilus DNA ligase, a homolog of Escherichia coli DNA...Identification of essential residues in Thermus thermophilus DNA ligase." Nucleic acids research 24.15 (1996...for characterization of resistance-mediating polymorphisms in African samples of Plasmodium falciparum....

...guide for a refresher on CRISPR/Cas9.  Figure 1: Cpf1 is a single RNA-guided endonuclease of a class... than the multi-subunit complex employed by class 1 systems. A putative new class 2 nuclease, Cpf1 (CRISPR...that Cpf1 can tolerate mismatches at gRNA positions 1, 8, 9, and 19-23. Accordingly, the 3’ end of the gRNA...Most gRNAs directed low-frequency Cpf1 cleavage at 1-12 off-target sites; in contrast, SpCas9 may cleave...the diversity of CRISPR-based systems. References 1. Zetsche, Bernd, et al. "Cpf1 is a single RNA-guided... off-target editing rates, determined using sophisticated genome-wide analysis. At many of its computationally...

...follow her on Twitter @nieminm.   References 1. Cohen, Philip. "The origins of protein phosphorylation."...cellular proteins are modified through phosphorylation (1). However, the expansion of studies on protein phosphorylation...three components required for translation (Figure 1): A tRNA that recognizes a specific ‘open’ codon ... open reading frame (ORF) of interest (Figure 2). 1. The phosphoserine OTS The backbone of the phosphoserine...modification allowed the deletion of release factor 1, the protein responsible for terminating translation...Rinehart lab: pCRT7 NT TOPO E17TAG GFP and pGEX-6P-1. The pCRT7 NT TOPO vector contains a mutant pSer-containing...

... compounds with various antimicrobial activities (1). She has developed a fast endophyte screening system...us coordinate and promote the awards. References 1. Martinez-Klimova, Elena et al. “Endophytes as sources...antibiotic” Biochemical Pharmacology 2017 Jun 15;134:1-17. PubMed PMID: 27984002. 2. Bilan, Dmitry S. et ...working in a wide range of research fields and geographical locations. We are excited to see how all of ...

...depths (1 mm), important for certain applications such as in vivo tissue imaging.   Figure 1: Ace-mScarlet...sources – voltage-gated potassium channels found in Drosophila to phosphatases from sea squirts. This design... detector in this system was dipicrylamine, a lipophilic compound that distributes itself within the plasma...sensing) hydrolyzes a precursor dye to make it more lipophilic, increasing its affinity for the membrane, where... fluorescent component (i.e., when the dye is lipophilic and integrates into the membrane), the voltage...

... hybridization experiments. A recent publication [1] from the Sánchez lab describes the plasmids and protocols...deposit) are described in the Sánchez lab publication [1] so that the students performing these experiments...can easily investigate in planarians. References 1. Alice Accorsi, Monique M. Williams, Eric J. Ross,...Proceedings of the National Academy of Sciences 100.suppl 1 (2003): 11861-11865. PubMed PMID: 12917490. PubMed...pp. 806-811. PubMed PMID: 9486653. 3. Newmark, Phillip A., et al. "Ingestion of bacterially expressed ...

...acceptor fluorophore. The typical steps in FRET are: 1. Donor fluorophore excitation by absorption of a photon... overlap, the fluorophores must be located within 1-10nm of each other and be oriented appropriately for... from various papers to make the decision easier. 1. Müller, Sara M., et al. "Quantification of Förster...diseases and even assist in drug discovery. References 1. Baird, Geoffrey S., et al. "Circular permutation ...have enhanced the ability of labs to answer sophisticated questions about cellular processes. Currently...