...ultracentrifugation. The steps are clearly distinguishable thanks to the use of phenol red. Image adapted from Zolotukhin...

...dsDNA repair templates with homology to the DNA flanking the DSB and a specific edit close to the gRNA ...RNA. dPspCas13b does not require a Protospacer Flanking Sequence (PFS), making it a very flexible editing...

...Select the Insert tab, then Chart . This will add a blank chart to your spreadsheet. In the Chart Editor ,...

...large scale edits by integrating segments of DNA flanked by specific repeat elements into the genome. CRISPR-associated.... J., Hussmann, J. A., Yan, J., Knipping, F., Ravisankar, P., Chen, P., Chen, C., Nelson, J. W., Newby... PMID: 30323312 Yan, J., Oyler-Castrillo, P., Ravisankar, P., Ward, C. C., Levesque, S., Jing, Y., Simpson...D. B. T., Gootenberg, J. S., Abudayyeh, O. O., Franklin, B., Kellner, M. J., Joung, J., & Zhang, F. (2017...

...channel [K55/7R] Anti-Fig4/Sac3 [N202/7R] Anti-Ankyrin-G [N106/36] Generate anti-kinesin recombinant scFvs...: Antibodies (Link opens in a new window) Brain Banks (Link opens in a new window) Rodent Models (Link...

...can locate potential PAM and target sequences and rank the associated gRNAs based on their predicted on-target...interest can be PCR amplified using primers that (A) flank the region of interest (deletions or small insertions...

...cells, Cas13-ADAR2 does not require a specific flanking sequence on the target RNA, making it a very flexible...rather than DNA, sometimes requiring a protospacer flanking sequence (PFS). In bacteria, Cas13 targeting also...

...deletion). Use a pair of forward and reverse primers flanking each sgRNA target site (within 150 - 350 bp) to...This is a representative sequencing primer; other flanking primers may be utilized. Choose a sequence-verified...

...TATTAAATGCAGATAACCT 66089 cut S. pyogenes 25249454 Seydoux KANK3 H. sapiens GCATGGGTGATGTCAATGCC 69238 cut S. pyogenes...the subject heading "gRNA sequence spreadsheet". Thanks for helping us expand and improve our resources...

...oligos from section B contain the shRNA sequence flanked by sequences that are compatible with the sticky...

... each encoding a single TALE repeat domain and flanked by restriction sites used for ligation into longer...

...RNA. dPspCas13b does not require a Protospacer Flanking Sequence (PFS), making it a very flexible editing...

...Vectors pLEG/pREG Modular Viral Vector System - Dankort...

...Tool for Lineage Tracing: The ClonTracer Library (Frank Stegmeier) Tackling Cancers’ Drug Resistance with...

...dsDNA repair templates with 1. homology to the DNA flanking the DSB and 2. a specific edit close to the gRNA...

...dsDNA repair templates with homology to the DNA flanking the DSB and a specific edit close to the gRNA ...

...dsDNA repair templates with homology to the DNA flanking the DSB and a specific edit close to the gRNA ...

...Plasmids (empty backbones/controls): ID Plasmid GenBank Key Features 26092 p15TV-L EF456736 Hexahistidine...

...Publications Kaufman, M. L., Goodson, N. B., Park, K. U., Schwanke, M., Office, E., Schneider, S. R., Abraham, J....

...dsDNA repair templates with homology to the DNA flanking the DSB and a specific edit close to the gRNA ...