We narrowed to 499 results for: Ank
-
TypeCollection...large scale edits by integrating segments of DNA flanked by specific repeat elements into the genome. CRISPR-associated.... J., Hussmann, J. A., Yan, J., Knipping, F., Ravisankar, P., Chen, P., Chen, C., Nelson, J. W., Newby... PMID: 30323312 Yan, J., Oyler-Castrillo, P., Ravisankar, P., Ward, C. C., Levesque, S., Jing, Y., Simpson...D. B. T., Gootenberg, J. S., Abudayyeh, O. O., Franklin, B., Kellner, M. J., Joung, J., & Zhang, F. (2017...
-
AAV Purification by Iodixanol Gradient Ultracentrifugation
TypeProtocol...ultracentrifugation. The steps are clearly distinguishable thanks to the use of phenol red. Image adapted from Zolotukhin... -
Neurodegeneration Research Collection
TypeCollection...channel [K55/7R] Anti-Fig4/Sac3 [N202/7R] Anti-Ankyrin-G [N106/36] Generate anti-kinesin recombinant scFvs...: Antibodies (Link opens in a new window) Brain Banks (Link opens in a new window) Rodent Models (Link... -
Coomassie Purity Stain of Recombinant Antibodies
TypeProtocol...Select the Insert tab, then Chart . This will add a blank chart to your spreadsheet. In the Chart Editor ,... -
Plan Your Experiment
TypeCollection...can locate potential PAM and target sequences and rank the associated gRNAs based on their predicted on-target...interest can be PCR amplified using primers that (A) flank the region of interest (deletions or small insertions... -
CRISPR History and Development for Genome Engineering
TypeCollection...cells, Cas13-ADAR2 does not require a specific flanking sequence on the target RNA, making it a very flexible...rather than DNA, sometimes requiring a protospacer flanking sequence (PFS). In bacteria, Cas13 targeting also... -
Genomic Deletions in Mammalian Cell Lines
TypeCollection...deletion). Use a pair of forward and reverse primers flanking each sgRNA target site (within 150 - 350 bp) to...This is a representative sequencing primer; other flanking primers may be utilized. Choose a sequence-verified... -
Validated gRNA Sequences
TypeCollection...TATTAAATGCAGATAACCT 66089 cut S. pyogenes 25249454 Seydoux KANK3 H. sapiens GCATGGGTGATGTCAATGCC 69238 cut S. pyogenes...the subject heading "gRNA sequence spreadsheet". Thanks for helping us expand and improve our resources... -
Protocol - pLKO.1 – TRC Cloning Vector
TypeProtocol...oligos from section B contain the shRNA sequence flanked by sequences that are compatible with the sticky... -
Depositor Collections
TypeCollection...Vectors pLEG/pREG Modular Viral Vector System - Dankort... -
Individual REAL TALE Repeat Plasmids
TypeCollection... each encoding a single TALE repeat domain and flanked by restriction sites used for ligation into longer... -
CRISPR Plasmids - RNA Editing
TypeCollection...RNA. dPspCas13b does not require a Protospacer Flanking Sequence (PFS), making it a very flexible editing... -
Cancer Research Plasmids and Resources
TypeCollection...Tool for Lineage Tracing: The ClonTracer Library (Frank Stegmeier) Tackling Cancers’ Drug Resistance with... -
CRISPR Plasmids - Double-Strand Break (Cut)
TypeCollection...dsDNA repair templates with 1. homology to the DNA flanking the DSB and 2. a specific edit close to the gRNA... -
CRISPR Plasmids - Zebrafish
TypeCollection...dsDNA repair templates with homology to the DNA flanking the DSB and a specific edit close to the gRNA ... -
CRISPR Plasmids - Parasites
TypeCollection...dsDNA repair templates with homology to the DNA flanking the DSB and a specific edit close to the gRNA ... -
Structural Genomics Consortium Plasmids
TypeCollection...Plasmids (empty backbones/controls): ID Plasmid GenBank Key Features 26092 p15TV-L EF456736 Hexahistidine... -
Brzezinski Lab CRISPR Collection
TypeCollection...Publications Kaufman, M. L., Goodson, N. B., Park, K. U., Schwanke, M., Office, E., Schneider, S. R., Abraham, J.... -
CRISPR Plasmids - C. elegans
TypeCollection...dsDNA repair templates with homology to the DNA flanking the DSB and a specific edit close to the gRNA ... -
CRISPR Plasmids - Drosophila
TypeCollection...dsDNA repair templates with homology to the DNA flanking the DSB and a specific edit close to the gRNA ...