We narrowed to 503 results for: Ank;
- 
  TypeCollection...dsDNA repair templates with homology to the DNA flanking the DSB and a specific edit close to the gRNA ...RNA. dPspCas13b does not require a Protospacer Flanking Sequence (PFS), making it a very flexible editing...
 - 
  
CRISPR Guide
TypeCollection...large scale edits by integrating segments of DNA flanked by specific repeat elements into the genome. CRISPR-associated.... J., Hussmann, J. A., Yan, J., Knipping, F., Ravisankar, P., Chen, P., Chen, C., Nelson, J. W., Newby... PMID: 30323312 Yan, J., Oyler-Castrillo, P., Ravisankar, P., Ward, C. C., Levesque, S., Jing, Y., Simpson...D. B. T., Gootenberg, J. S., Abudayyeh, O. O., Franklin, B., Kellner, M. J., Joung, J., & Zhang, F. (2017... - 
  
Coomassie Purity Stain of Recombinant Antibodies
TypeProtocol...Select the Insert tab, then Chart . This will add a blank chart to your spreadsheet. In the Chart Editor ,... - 
  
Neurodegeneration Research Collection
TypeCollection...channel [K55/7R] Anti-Fig4/Sac3 [N202/7R] Anti-Ankyrin-G [N106/36] Generate anti-kinesin recombinant scFvs...: Antibodies (Link opens in a new window) Brain Banks (Link opens in a new window) Rodent Models (Link... - 
  
Luciferase Plasmid Collection
TypeCollection...expression of Nanoluc with a N-terminal Myc tag Erich Wanker 124701 pLenti-PGK-Venus-Akaluc (neo) Akaluc hPGK...expression of Nanoluc with a N-terminal Myc tag Erich Wanker 115352 pFL-SV40 Firefly SV40 Mammalian expression... - 
  
CRISPR History and Development for Genome Engineering
TypeCollection...cells, Cas13-ADAR2 does not require a specific flanking sequence on the target RNA, making it a very flexible...rather than DNA, sometimes requiring a protospacer flanking sequence (PFS). In bacteria, Cas13 targeting also... - 
  
Validated gRNA Sequences
TypeCollection...TATTAAATGCAGATAACCT 66089 cut S. pyogenes 25249454 Seydoux KANK3 H. sapiens GCATGGGTGATGTCAATGCC 69238 cut S. pyogenes...the subject heading "gRNA sequence spreadsheet". Thanks for helping us expand and improve our resources... - 
  
Protocol - pLKO.1 – TRC Cloning Vector
TypeProtocol...oligos from section B contain the shRNA sequence flanked by sequences that are compatible with the sticky... - 
  
CRISPR Plasmids - RNA Editing
TypeCollection...RNA. dPspCas13b does not require a Protospacer Flanking Sequence (PFS), making it a very flexible editing... - 
  
Depositor Collections
TypeCollection...Vectors pLEG/pREG Modular Viral Vector System - Dankort Gene Vector Core Viral Vectors - Oka... - 
  
Cancer Research Plasmids and Resources
TypeCollection...Tool for Lineage Tracing: The ClonTracer Library (Frank Stegmeier) Tackling Cancers’ Drug Resistance with... - 
  
Structural Genomics Consortium Plasmids
TypeCollection...Plasmids (empty backbones/controls) ID Plasmid GenBank Key Features 26092 p15TV-L EF456736 Hexahistidine... - 
  
CRISPR Plasmids - Double-Strand Break (Cut)
TypeCollection... DNA repair templates with homology to the DNA flanking the DSB and a specific edit close to the gRNA ... - 
  
CRISPR Plasmids - Zebrafish
TypeCollection...dsDNA repair templates with homology to the DNA flanking the DSB and a specific edit close to the gRNA ... - 
  
CRISPR Plasmids - Parasites
TypeCollection...dsDNA repair templates with homology to the DNA flanking the DSB and a specific edit close to the gRNA ... - 
  
Brzezinski Lab CRISPR Collection
TypeCollection...Publications Kaufman, M. L., Goodson, N. B., Park, K. U., Schwanke, M., Office, E., Schneider, S. R., Abraham, J.... - 
  
CRISPR Plasmids - C. elegans
TypeCollection...dsDNA repair templates with homology to the DNA flanking the DSB and a specific edit close to the gRNA ... - 
  
CRISPR Plasmids - Drosophila
TypeCollection...dsDNA repair templates with homology to the DNA flanking the DSB and a specific edit close to the gRNA ... - 
  
CRISPR Plasmids - Yeast
TypeCollection...dsDNA repair templates with homology to the DNA flanking the DSB and a specific edit close to the gRNA ... - 
  
Retrovirus Plasmids
TypeCollection...contains transgene, sgRNA, or shRNA of interest flanked by LTRs Packaging plasmid — contains packaging ...