...purpose="decorative" title="Check icon" %} Just bacteria {% icon icon_set="fontawesome-5.14.0" name="Check...16" purpose="decorative" title="Check icon" %} {% icon icon_set="fontawesome-5.14.0" name="Check" style...decorative" title="Check icon" %} Carbenicillin Excellent {% icon icon_set="fontawesome-5.14.0" name...="Check icon" %} Spectinomycin Excellent No Just bacteria Not SHuffle cells {% icon icon_set="fontawesome...No satellite colonies? Ampicillin Fair {% icon icon_set="fontawesome-5.14.0" name="Check" style="SOLID...

... risk of an antibody.  In silico prediction of adverse reactions In silico assessment uses computer modeling... 2022.   Limitations of the in silico approach The in silico approach cannot replicate the complexity...from the in silico assessments, as well as analyze the contributing factors that in silico prediction ...responses vary depending on the person. However, in silico and in vitro assessment of immunogenicity can help... evaluate the immunogenicity of therapeutics in silico. These algorithms are trained on vast amounts of...and the efficacy.  Better together Combining in silico and in vitro approaches enables researchers to ...safer and more effective mAb therapeutics. The in silico method of immunogenicity assessment can help in...

...targeting the pMB1 replicon on pTargetF (Jiang et al., 2015). In addition to the pMB1 replicon, pTargetF contains...PrhaB, 2) changed the replicon of pCas into a non-temperature-sensitive replicon, and 3) added the sacB...for multicopy chromosomal integration (ex: for protein expression) (Zhang et al., 2020). Multicopy chromosomal... Most recently, we’ve developed a new system “Multicopy chromosomal integration using CRISPR-associated... the S. pyogenes Cas9, a temperature-sensitive replicon for self-curing, an arabinose inducible lambda-red... expression of the sgRNA that targets the pMB1 replicon, resulting in cutting of the plasmid. At this ... the gRNA on pCas that is specific to the pMB1 replicon of pTargetF may exhibit a more serious leaky expression...

...been uniquely challenging to apply in dicotyledonous plants, or dicots. But Jae-Yean Kim’s lab recently "... find in this post: Optimized prime editing in dicots Self-labeling tags for single-molecule biophysics...neurodegeneration research   Optimized prime editing in dicots By Emily P. Bentley Prime editing (PE), initially...delivered with an enhanced pU6cm promoter, viral replicon amplification of cargo, and heat treatment.  ...editing tools PE2max-NC and ePEmax3 optimized for dicots. NC: nucleocapsid RNA chaperone, RT: reverse transcriptase...suggesting the improvements may be broadly applicable to dicot species. In addition, they generated offspring tomato... improve rapid and precise plant breeding. Find dicot prime editing plasmids here! Vu, T. V., Nguyen,...

...experiment is targeted amplicon sequencing. The information from targeted amplicon sequencing is highly ... genome for off-target sites irrespective of in silico prediction. These techniques differ in important...heterogenous populations, low sensitivity Targeted Amplicon Sequencing Provided 0.01% (variable) Sequence-...rate and the repair product sequence. Targeted amplicon sequencing doesn’t tell the whole story ...These strategies can be used in concert with in silico prediction to create a more comprehensive list ...unbiased detection isn’t as sensitive as targeted amplicon sequencing. For example, GUIDE-seq seems to have...contrasts with detection frequencies of 0.01% in amplicon sequencing (Hendel et al. 2015), a significant...

...inducible dcas9 gene on a p15A vector with chloramphenicol resistance. The second plasmid ( pgRNA_bacteria...activation domain and tagBFP 46914 pU6-sgGFP-NT1 Human pSico-based U6 vector containing murine U6 promoter and...sgRNA targeting GFP (NT1) 46917 pU6-sgCXCR4-2 Human pSico-based U6 vector containing murine U6 promoter and...sequence of human MUC4 exon 3 46915 pU6-sgGAL4-1 Human pSico-based U6 vector containing murine U6 promoter and...targeting GAL4 UAS promoter 46916 pU6-sgGAL4-4 Human pSico-based U6 vector containing murine U6 promoter and...promoter (negative control) 46918 pU6-sgCD71-2 Human pSico-based U6 vector containing murine U6 promoter and...

... and dsDNA. This is not true for all amplicons; if your amplicon is AT-rich or has a secondary structure...Allelic specificity Can be multiplexed Single amplicon validation technique Hydrolysis Probes (Taqman...Bustin, 2017 for a more in-depth review.)  Your amplicon should be between 70-200 bp long With ΔΔCT analysis... intensity should smoothly increase as the DNA amplicon transitions from single-stranded to double-stranded...final temperature increase. If there is a single amplicon, there should only be one peak, as everything ... the same temperatures. If there are multiple amplicons, or primer dimers forming, the curve will show...curves showsing (a) a single peak, indicating one amplicon and no primer dimers. (b) A shoulder peak indicating...

...similar plasmids pSicoR PGK puro , pSicoR-Ef1a-mCh-Puro , pSicoR-Ef1a-mCh and pSicoR-mCh-empty Lentiviral...PI 11578 pSico Cre activates shRNA expression, removal of EGFP; See also similar plasmids pSico PGK GFP...GFP and pSico PGK puro Lentiviral Jacks 11579 pSicoR Cre turns off shRNA expression, removal of EGFP; See...

...Campbell Voltage Multicoloured voltage reporters (QuasAr2) Bright and fast multicoloured voltage reporters...plasmids; these are noted with the viral service icon . Metal Ions Target Description Article PI Calcium...Biol. 2010 Apr 16;5(4):415-25. Martin Webb ATP Multicolor palette of ATP indicators (MaLion) RGB-color ...Cell Rep. 2019 Jun 25;27(13):4003-4012.e6. Xavier Nicol cyclic di-GMP FRET-based biosensor for cyclic-di-GMP...biosensors for mapping cellular concentrations of nicotinamide adenine dinucleotides. eLife. 2018 May 29;7.... and green GPCR-based NE indicators Sensitive multicolor indicators for monitoring norepinephrine in vivo...elevations. J Biol Chem. 2011 Apr 1;286(13):11672-84. Nicolas Demaurex pH Rosella Fluorescent pH-biosensor for...

...problem was the creation of an Addgene lexicon. The base lexicon was and continues to be a list of commonly...every new Addgene employee gets “Lexicon Training.” Since the lexicon is a “living” document, I update...format” all received formal definitions in our lexicon. We created documents and presentations, gave real...technology in a consistent way. Just creating a lexicon was not enough. We also had to enforce and maintain...

... T. denticola 24076762 Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48656 cut T. denticola 24076762...cut S. pyogenes 23287722 Church actII-orf4 S. coelicolor ATTACCAGGGACCGGAGTTC 62552 cut S. pyogenes 25739462...musculus 64071 cut S. pyogenes 25337876 Ventura Amplicon, JAK2 H. sapiens GAGGCATATTCTTCTCCTGG 70660 cut...GCGCTTACACTTTAGGAGACACTC 61080 purify S. pyogenes 25051498 Fujii JAK2 amplicon H. sapiens GGTTTAATGGAAGAGAAGGG 70679 cut S. pyogenes... 70018 cut S. pyogenes 26541286 Voytas BCR/ABL amplicon H. sapiens GGCTCCCTTCAAGTGGGATG 70658 cut S. pyogenes...

...It is a well known fact if a multicopy variant of a gene exists, there must be assays that researchers...fluorescent probe and quencher to quantify specific amplicons.  Sybr has high background noise, due to the large... affected by AT-rich DNA and the length of the amplicon and it has a higher rate of false positives (Colborn...is not affected by AT content or length of the amplicon. As the probes can have several different markers...DNA quality and primer design, particularly for amplicons under 100 bp (Ma, 2015.) A schematic representation...confounding by AT-rich DNA and by variation in amplicon length. Am J Trop Med Hyg. 2008 Dec;79(6):887-...

... and W are known to have replicons with broad host ranges. Popular replicons from these groups include...Building broad host range recombinant vectors Replicons, which consist of a plasmid’s ori and all of its...2011 and Jain and Srivastava 2013. Family Replicon Compatible with Shown to work in IncN ...amylovora, E. carotovora subsp. Carotovora, E. herbicola, E. rubrifaciens, E. stewartii, Escherichia coli...In addition to incorporating broad host range replicons, recombinant vectors can be modified further to...

... any plasmid: the origin of replication/replicon. The replicon is comprised of the origin of replication...itself as it must to survive within cells. The replicons of plasmids are generally different from the those...regulation and can be manipulated with mutations in the replicon. For example, the pMB1 ori maintains about 20 ...amplifying more copies with the addition of chloramphenicol – make sure your growth conditions aren't working...

...General protein expression BL21 (DE3) pLysS* Chloramphenicol (pLysS) pLysS expresses T7 lysozyme to reduce...Expression of toxic proteins BL21 (DE3) pLysE* Chloramphenicol (pLysE) pLysE has higher T7 lysozyme expression...Expression of insoluble proteins  Rosetta2 (DE3)* Chloramphenicol (pRARE) Good for “universal” translation; contains...Expression of eukaryotic proteins Lemo21 (DE3)* Chloramphenicol (pLemo) Rhamnose-tunable T7 RNAP expression...T7 expression. The pLys plasmid contains a chloramphenicol resistance cassette for positive selection ...

...apply a variety of CRISPR tools to dicotyledonous plants. The pDGE Dicot Genome Editing Kit contains Cas9... PubMed PMID: 25730490 New kit for editing dicotyledonous plants The Stuttmann lab generated the vectors...CRISPR knockout pooled library Parasites from the apicomplexan phylum cause severe human and livestock diseases...Despite their importance to global health, most apicomplexan genes remain uncharacterized. Recent studies...the contribution of each gene from the model apicomplexan organism Toxoplasma gondii to the infection ...uncharacterized genes that are conserved among apicomplexans and important for T. gondii fitness. Sixteen... cells, and one of them called “claudin-like apicomplexan microneme protein” (CLAMP) was shown to be important...

... you'll need Sanger sequencing reads from PCR amplicons that cover your locus of interest and correspond... from a deep sequencing experiment a reference amplicon sequence to assess and quantify the efficiency...efficiency of the targeted mutagenesis The amplicon sequence expected after HDR can be provided as an optional...CRISPResso suite accommodates single or pooled amplicon deep sequencing, WGS datasets and allows the direct...

...pyogenes Chloramphenicol Marraffini pCas9 42876 Bacteria BsaI yes, cut S. pyogenes Chloramphenicol Marraffini... pKS diaCas9_sgRNA 74923 Other/Phaeodactylum tricornutum U6 yes, cut S. pyogenes Winge pJJR50 75026 Worm...gRNA module vectors, including three designed for dicots and three designed for monocots. Using these gRNA...High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants Plant PCR-based procedure to rapidly generate...

...and drop an icon onto the workspace. The color and size of icons are adjustable. New icons can be requested...scientists. The web-based collection of over 20,000 icons is designed by professional medical illustrators...

...Nagai laboratory has assembled a collection of multicolored nano-lanterns for use in various applications...appropriate for use with Nano-lantern technology. Multicolor imaging using Nano-lanterns requires a linear...Expanded palette of Nano-lanterns for real-time multicolor luminescence imaging.” Proc Natl Acad Sci U S... of bright luminescent protein for real-time multicolour bioimaging.” Nat Commun. 7 (2016): 13718. PMID...