Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 650 results for: CHI;

Showing: 631 - 650 of 650 results

  6. Antibodies 101: Validation

    Type
    Blog Post
    ... it’s important to know what you are aiming to achieve. In general, these are three core goals of antibody...

  8. Optogenetics Guide

    Type
    Guide
    ...channels- chimeras C1C2 ChR1-ChR2 chimera 470 ChIEF, ChEF, ChD Engineered by chimeragenesis of ChR1 and...genetic point mutations, codon optimization, and chimeric fusion of domains from two different ChRs. These...photocurrent amplitude Examples: ChR2(H134R), C1V1(t/t), ChIEF Increased channel (on/off) kinetics: Examples: ChETA...and ChR2 450-470 C1V1 ChR1-VChR1 chimera with E122T and E162T mutations 540 Channelrhodopsins: chloride...inhibitory ChR with mutation C128A (derived from C1C2 chimera) 475 GtACR Chloride-conducting channel from Guillardia...Generally, the most robust and stable expression is achieved in a transgenic mouse line, such as for example...targets into large, optically assembled protein architectures in living mammalian cells. LITE Two-hybrid system...

  11. Sequencing Primers

    Type
    Guide
    ...reverse primer pTrcHis Forward GAGGTATATATTAATGTATCG (Invitrogen) 5' of MCS in pTrcHis vector, forward...forward primer pTrcHis Reverse GATTTAATCTGTATCAGG (Invitrogen) 3' of MCS in pTrcHis vector, same as pBAD-R,...List 3'AOX1 GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1 terminator, reverse primer 5'...5'AOX1 GACTGGTTCCAATTGACAAGC (Invitrogen) For Pichia vectors with AOX1 promoter, forward primer 35S promoter...Forward CAATTTACATCTTTATTTATTAACG (Invitrogen) For Pichia vectors with AUG1 promoter, forward primer AUG1...Reverse GAAGAGAAAAACATTAGTTGGC (Invitrogen) For Pichia vectors with AUG1 promoter, reverse primer BGH ...

  13. Molecular Biology Reference

    Type
    Guide
    ...using a sequencing machine that recognizes the different fluorescent labels. The machine detects which fluorescently...replication (by bacteria) by recruiting DNA replication machinery. The ori is critical for the ability of the plasmid... in the bacteria by bacterial transcriptional machinery. Multiple Cloning Site (MCS) Short segment of ...promoter is designed to recruit transcriptional machinery from a particular organism or group of organisms... direct cell-specific expression, which can be achieved by a tissue-specific promoter (e.g., a liver-specific... when sequencing is not 100% efficient and the machine cannot distinguish between the 4 labelled nucleotides...

  14. Lentiviral Vector Guide

    Type
    Guide
    ...system. Instead, the transfer plasmid contains a chimeric 5’ LTR fused to a heterologous promoter (often...Transfer plasmid — contains transgene and LTRs (chimeric 5’ LTR) Packaging plasmid 1 — contains gag and... to predict. In therapeutic applications, like chimeric antigen receptor T cell (CAR-T) therapy, the location...glycoprotein — transduce neural progenitor and stem cells Chimeric envelope genes have also gained popularity to ...accessibility (DIVA) identifies alterations in chromatin architecture through large-scale mapping of lentiviral integration... (1997). Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo. Nature Biotechnology...

  15. Chemogenetics Guide

    Type
    Guide
    ...Adeno-associated virus (AAV) is a widely-used tool for achieving in vivo expression of chemogenetic receptors, ... our AAV guide . FLEx Vectors are also used to achieve cell-specific expression of AAV-encoded chemogenetic...Mathews WB, Sysa-Shah P, Rodriguez LA, Ellis RJ, Richie CT, Harvey BK, Dannals RF, Pomper MG, Bonci A, ...M-R, Tomita Y, Nakahara J, Suhara T, Takada M, Higuchi M, Jin J, Roth BL, Minamimoto T (2020). Deschloroclozapine...Mouravlev A, Carpenter JC, Snowball A, Knauss S, von Schimmelmann M, During MJ, Lignani G, Schorge S, Young D,...

  16. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...replication as it activates the necessary cellular machinery to produce large amounts of rAAV vectors. The ... vector depends on the cell’s DNA replication machinery to synthesize the complementary strand, transgene...rAAV capsids. Learn more about optogenetics by watching our Optogenetics 101 video or by visiting Addgene's...Kuleshova, E., Ojala, D., Huang, C. C., Gerfen, C. R., Schiller, J., Dudman, J. T., Hantman, A. W., Looger, L....replication process where the virus uses the cell machinery to produce new viruses, eventually lysing the ...

  17. Adenovirus Guide

    Type
    Guide
    ...plasmid and the adenoviral backbone plasmid have matching left and right homology arms which facilitate ...have been developed to reduce immune response and achieve longer transgene expression. Adenoviral Types Serotypes...such as COVID-19, Ebola virus, and Zika virus. Chimpanzee adenoviral (ChAdV) vectors have also been developed...Gilbert, S. C., Hill, A. V. S., & Lambe, T. (2017). Chimpanzee adenoviral vectors as vaccines for outbreak pathogens...

  18. Cloning

    Type
    Guide
    ...Gibson Type IIS Ligation Independent Cloning Oligo Stitching Molecular cloning or the creation of recombinant...Top Yeast-mediated Cloning and Oligonucleotide Stitching Yeast-mediated cloning is very similar in principle...advantage is the ability to perform oligonucleotide stitching, in which pieces of DNA that share no end homology...

  19. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...cancer or immunodeficiency disorders. Delivery of chimeric antigen receptor T cell (CAR-T) therapy is a particularly...vectors using a novel, CoDOn-Optimized gene for chimeric GALV envelope. Viruses , 13 (8), 1471. https:/...

  20. Plan Your Experiment

    Type
    Guide
    ...reagents may be sufficient to express the CRISPR machinery. For more difficult cells (e.g. primary cells)...
Showing: 631 - 650 of 650 results