Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 472 results for: Sele

Showing: 461 - 472 of 472 results

  1. Antibody Guide

    Type
    Guide
    ...nuclei, AF488, AF555, and AF647 Antibody Selection Selecting the right antibody for your experiment is...section to help you select antibodies for your approach. Primary antibodies To select an antibody, first...Methods Cell Sorting Methods Multiplex Assays Selection Validation Affinity reagents are molecular tools...mid-forties. When designing a multiplex assay, selection of the fluorophores used is important. It is best...appropriate lasers and filters for each fluorophore you select. Suggested panels for small multiplex experiments... you may either purchase several to compare, or select one based on price, shipping availability, ease... called secondaries, are usually much easier to select. There are three main considerations. What is the...

  2. Chemogenetics Guide

    Type
    Guide
    ...manipulation of ion channels arePharmacologically Selective Actuator Modules (PSAMs, pronounced SAMs). PSAMs...specific small molecules termed Pharmacologically Selective Effector Molecules (PSEMs). PSAM domains were ...domain with a Glycine-receptor (GlyR) chloride-selective IPD. Binding of the cognate PSEM allows for the...-HT 3 serotonin receptor sodium- or potassium-selective IPD. Binding of the cognate PSEM allows for influx...Calakos N, Roth BL (2012). A Gαs DREADD Mouse for Selective Modulation of cAMP Production in Striatopallidal...SM (2011). Chemical and genetic engineering of selective ion channel-ligand interactions. Science. 333:...Minamimoto T (2020). Deschloroclozapine, a potent and selective chemogenetic actuator enables rapid neuronal and...

  3. Gamma-Retroviral Vector Guide

    Type
    Guide
    ... type of selectable marker. Fluorescent reporters, such as GFP, are another common selection marker. Instead...lentiviral vectors. Many gamma-retroviral vectors have selectable markers, such as the puromycin resistance gene... Instead of selection by an antibiotic, fluorescence-activated cell sorting (FACS) is used to sort cells...& Burgess, S. M. (2014). MLV integration site selection is driven by strong enhancers and active promoters...

  4. CRISPR Guide

    Type
    Guide
    ... complex functions, including the ability to selectively activate/repress target genes, purify specific...additional Cas proteins and PAM sequences . Once you’ve selected your target, you’ll express your gRNA and Cas9...There are many online tools available to help you select an optimized gRNA for your application (see: Plan...is generally low (< 10% of modified alleles). Selecting a target cut site as close as possible to the ...design for CRISPR libraries is usually optimized to select for gRNAs with high on-target activity and low ... available in two formats: as liquid DNA, or in select cases, as pre-made lentivirus . DNA libraries are...

  5. Lentiviral Vector Guide

    Type
    Guide
    ... type of selectable marker. Fluorescent reporters, such as GFP, are another common selection marker. Instead...a host’s genome. Many lentiviral vectors have selectable markers, such as the puromycin resistance gene... Instead of selection by an antibiotic, fluorescence-activated cell sorting (FACS) is used to sort cells...

  6. Educational Resources

    Type
    Guide
    ...include: Antibiotic Concentrations for Bacterial Selection What is a Plasmid? Genetic Code Strain Information...

  7. Science Guides

    Type
    Guide
    ...that uses genetically engineered receptors to selectively control and investigate cell signaling pathways...

  8. Sequencing Primers

    Type
    Guide
    ...pRS-marker CGGCATCAGAGCAGATTGTA To sequence yeast selectable marker in pRS vectors Pry1 CTTAGCATGTCCGTGGGGTTTGAAT...

  9. Cloning

    Type
    Guide
    ...of promoters and into backbones with different selection cassettes). Although gateway cloning is a simple...

  10. Modular Cloning Guide

    Type
    Guide
    ...plasmids, including origins of replication and selection markers for a variety of bacterial and fungal ...

  11. Optogenetics Guide

    Type
    Guide
    ...Blue-shifted iC++ variant 467 Aurora Red-shifted anion-selective ReaChR variant 517 Halorhodopsins Jaws Red-shifted...

  12. Adenovirus Guide

    Type
    Guide
    ...replication-competent adenoviral vectors that can selectively infect, divide in, and lyse tumor cells. Viral...
Showing: 461 - 472 of 472 results