We narrowed to 466 results for: Sele
-
TypeGuide...include: Antibiotic Concentrations for Bacterial Selection What is a Plasmid? Genetic Code Strain Information...
-
Science Guides
TypeGuide...that uses genetically engineered receptors to selectively control and investigate cell signaling pathways... -
Sequencing Primers
TypeGuide...pRS-marker CGGCATCAGAGCAGATTGTA To sequence yeast selectable marker in pRS vectors Pry1 CTTAGCATGTCCGTGGGGTTTGAAT... -
Cloning
TypeGuide...of promoters and into backbones with different selection cassettes). Although gateway cloning is a simple... -
Optogenetics Guide
TypeGuide...Blue-shifted iC++ variant 467 Aurora Red-shifted anion-selective ReaChR variant 517 Halorhodopsins Jaws Red-shifted... -
Adenovirus Guide
TypeGuide...replication-competent adenoviral vectors that can selectively infect, divide in, and lyse tumor cells. Viral...