Skip to main content

We narrowed to 516 results for: Trac;

Showing: 501 - 516 of 516 results
  1. Deep Dive: qPCR

    Type
    Blog Post
    ...method, and other small variations in consumables. Track and record these details for reproducibility’s sake...
  2. 15 Hot Plasmids from 2017

    Type
    Blog Post
    ...discovered reprogramming discrepancies, which they traced to a 9 amino acid N-terminal variation in the Klf4...
  3. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...you to track neurons that send information to a given region. This allows researchers to trace connections...using AAV for neuronal tracing . Browse AAV vectors for monosynaptic neuronal tracing available at Addgene... particles produced in HEK293T cells are then extracted and purified for their use as viral vectors to...molecular weight structures that are maintained extrachromosomally. Random integration of rAAV genomes in non-homologous... capsid could avoid invasive methods such as intracranial injection. Systemic capsids are often derived... a specific brain region, AAVrg would enter and track the terminal axons present in that region and move...diseases such as cystic fibrosis and cancer. Neuronal Tracing Recombinant AAV vectors have been widely used by...
  4. Chemogenetics Guide

    Type
    Guide
    ...important for dosing in animal studies, made them attractive targets for development into chemogenetic tools...stimulating phospholipase C, which releases intracellular calcium stores. There are currently three Gq...and activate neuronal signaling by increasing intracellular cAMP concentrations. There is currently one ... was created by replacing the corresponding intracellular region of a turkey erythrocyte β-adrenergic ...the same back-metabolism issues as CNO and are attractive alternatives for experiments. Perlapine has been...used in human populations in Japan, making it an attractive option for translational studies, however, it...be an agonist against hM4Di, and is especially attractive for use in translational studies because it is...
  5. Guide to Using Pooled Libraries

    Type
    Guide
    ...Functional Screens New Tool for Lineage Tracing: The ClonTracer Library NGS Quality Control for Pooled ...that can be used for applications like lineage tracing, drug screening, and gene function studies. In ...cells, making barcode libraries ideal for lineage tracing. Barcode libraries can be used for clonal fitness...tumors. Advantages Extremely high resolution clonal tracking Low biological perturbation Limitations No functional... may require specialized systems Limited to extracellular interactions or display-compatible proteins ...
  6. Antibody Guide

    Type
    Guide
    ...samples to extract proteins. Homogenize (tissues only), lyse, and then collect protein extract by centrifugation...and therefore should be kept at 4 °C. Record and track lot numbers for all antibodies used in the lab. ...application Process tissue or cell culture samples to extract proteins. Homogenize (tissues only) and lyse. Cross-link...In IHC, tissue sections are assayed and the extracellular matrix remains intact. The signaling molecule...enzyme. In ICC, cells have most or all of their extracellular matrix removed. Again, the signaling molecule...
  7. Adenovirus Guide

    Type
    Guide
    ...recombine to form one: Shuttle/transfer plasmid (e.g. pAdTrack) — containing the transgene of interest and both...multiple shuttle plasmids for different purposes. The pAdTrack series contains an IRES-GFP construct that enables...transgene of interest. With these plasmids, one can track the infection of HEK293/HER911 cells throughout ...into the host genome. Instead, they remain as extrachromosomal elements within the nucleus, normally as double-stranded...lacks E1, E3, and E4. Useful for larger inserts. pAdTrack Class of shuttle/transfer vectors for recombinant...
  8. Molecular Biology Reference

    Type
    Guide
    ...coined the term plasmid, in reference to any extrachromosomal heritable determinant. Plasmids are fragments...their intended purpose. When a plasmid exists extrachromosomally in E. coli , it is replicated independently...rod-shaped bacteria naturally found in the intestinal tract of animals. There are many different naturally occurring.../mL 50 µg/mL Spectinomycin 50 mg/mL 50 µg/mL Tetracycline 10 mg/mL 10 µg/mL *Carbenicillin can be used...
  9. CRISPR Guide

    Type
    Guide
    ...dynamic tracking of repetitive and non-repetitive genomic loci, chromosome painting, and RNA tracking in living...editing can specify a single mutation, even within a tract of identical bases. Browse Plasmids: Prime Edit ...proteins that target RNA instead of DNA enables tracking of RNA in live cells, including orthogonal RNA...synthetic fusion of the endogenous bacterial crRNA and tracrRNA that provides both targeting specificity and scaffolding...
  10. Lentiviral Vector Guide

    Type
    Guide
    ...makes lentiviral libraries popular for lineage tracing experiments and monitoring the dynamics of heterogeneous...transcription started by 5' LTR by the addition of a polyA tract just after the R sequence. WPRE in cis Woodchuck...viral packaging. cPPT in cis Central polypurine tract; recognition site for proviral DNA synthesis. Increases...
  11. Promoters

    Type
    Guide
    ...elongation factor promoter TRE Inducible Multiple Tetracycline response element promoter; often optimized for...such as shRNAs and gRNAs. Additional Resources Tetracycline (Tet) Inducible Expression Plasmids 101: The...
  12. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...transcription started by 5' LTR by the addition of a polyA tract just after the R sequence. WPRE in cis Woodchuck...viral packaging. cPPT in cis Central polypurine tract; recognition site for proviral DNA synthesis. Increases...
  13. Optogenetics Guide

    Type
    Guide
    ...to as an optoGPCR or OptoXR). Combining the extracellular domain of an endogenous light-sensitive receptor...receptor, like mammalian rhodopsin, with the intracellular domain of an endogenous GPCR, such as adrenergic...
  14. Sequencing Primers

    Type
    Guide
    ...Reverse Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance gene Reverse TK-pA-R TTGTCTCCTTCCGTGTTTCA...
Showing: 501 - 516 of 516 results