Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 506 results for: Trac;

Showing: 501 - 506 of 506 results

  1. CRISPR Guide

    Type
    Guide
    ...dynamic tracking of repetitive and non-repetitive genomic loci, chromosome painting, and RNA tracking in living...editing can specify a single mutation, even within a tract of identical bases. Browse Plasmids: Prime Edit ...proteins that target RNA instead of DNA enables tracking of RNA in live cells, including orthogonal RNA...synthetic fusion of the endogenous bacterial crRNA and tracrRNA that provides both targeting specificity and scaffolding...

  2. Guide to Using Pooled Libraries

    Type
    Guide
    ...Functional Screens New Tool for Lineage Tracing: The ClonTracer Library...that can be used for applications like lineage tracing or parsing the effects of expressing multiple genes...

  3. Lentiviral Vector Guide

    Type
    Guide
    ...makes lentiviral libraries popular for lineage tracing experiments and monitoring the dynamics of heterogeneous...transcription started by 5' LTR by the addition of a polyA tract just after the R sequence. WPRE in cis Woodchuck...viral packaging. cPPT in cis Central polypurine tract; recognition site for proviral DNA synthesis. Increases...

  4. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...transcription started by 5' LTR by the addition of a polyA tract just after the R sequence. WPRE in cis Woodchuck...viral packaging. cPPT in cis Central polypurine tract; recognition site for proviral DNA synthesis. Increases...

  5. Promoters

    Type
    Guide
    ...from phospholycerate kinase gene TRE Inducible Tetracycline response element promoter U6 Constitutive Human...

  6. Sequencing Primers

    Type
    Guide
    ... primer Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance gene, reverse primer TK-pA-R TTGTCTCCTTCCGTGTTTCA...
Showing: 501 - 506 of 506 results