...Hai-Ning Du Lab. A set of pCS2+ backbone-based Gateway destination vectors (pGCS), bearing either amino...HA, Flag, GST and eGFP epitopes. Zebrafish Tol2 Gateway-compatible Kit for Neurodegenerative Disorders ...

...vectors from the Esposito Lab for use with the Gateway® Cloning Platform (Life Technologies™) to permit...

...Publication Additional Resources Kits MoClo-YTK Yeast Gateway Kit Multiplex Yeast Toolkit (MYT) Markerless Yeast...

...; dCas9 activator gateway donors: pAC84 , pAC1 , pAC147 , pAC148 , pAC149 ; Gateway destination: pAC90...

...Recombinant Phosphoprotein Kit S. cerevisiae Advanced Gateway Destination Vectors TAL Effectors Zinc Finger Consortium...

... which allows easy creation of long hpRNA with Gateway-based cloning and straightforward positive selection...

...pEZYshuttle Shuttle Modified pShuttle-CMV plasmid with Gateway cassette; See article for additional plasmids Zhang...

...For plasmids containing the ccdB gene, such as Gateway vectors, we recommend the ccdB Survival strain....

...in intact cells. The Gradia Lab has deposited a gateway vector with Addgene, where you can insert your ...

...assembly. Gersbach MuLE System Mammalian MultiSite Gateway recombination-based cloning of complex polycistronic...plasmids available for use in this Golden Gate and Gateway based assembly method: plasmids for assembly of...a single T-DNA binary vector of choice through Gateway recombination. Qi Multiplex Conditional Mutagenesis...

...page. The data produced is available on the F1000 gateway and Zenodo community.  Knockdown approach For...

...used with Clover pGWF1 Cyan & Yellow Bacterial Gateway-compatible vector to express a gene of interest...

...vectors from the Esposito Lab for use with the Gateway® Cloning Platform (Life Technologies™) to permit...

...Back to Top Gateway® Recombination Cloning Gateway cloning (Image from Plasmid 101: Gateway Cloning ) Gateway... Gateway® cloning is a recombination based cloning method. The benefit of Gateway® is that moving a piece...cassettes). Although gateway cloning is a simple and efficient cloning method, gateway vectors and recombination...Guide Genome Engineering Guide Restriction Enzyme Gateway TOPO Gibson Type IIS Ligation Independent Cloning...fragment must first be amplified with specific Gateway attB1 and attB2 sites attached to the 5’ and 3’...sequence. This fragment can then be cloned into a gateway donor plasmid which contains compatible attP sites...it can be rapidly shuttled into any compatible Gateway® Destination vector, which contain attR sites via...

...specifically optimized for yeast Lindquist Lab Vectors - Gateway cloning; includes tagging with ECFP, EYFP, DsRed...

...including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction...compatible with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your...yield of DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant...

...GCATGATGACCACCGATATG 3' end of Gateway cassette, forward primer GW-5' AATCTCGCCGGATCCTAACT 5' end of Gateway cassette, reverse...

...including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction...compatible with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your...yield of DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant...

...including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction...compatible with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your...yield of DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant...

...including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction...compatible with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your...yield of DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant...