Cancer Research Plasmids and Resources
Type
Collection
...vectors from the Esposito Lab for use with the Gateway® Cloning Platform (Life Technologies™) to permit...
We narrowed to 63 results for: gateway
-
-
Botman-Teusink Yeast FP Collection
TypeCollection...Additional Resources Addgene Kits MoClo-YTK Yeast Gateway Kit Multiplex Yeast Toolkit (MYT) Markerless Yeast... -
Fluorescent Protein Guide: Empty Backbones
TypeCollection...pMH-Halo tag - Mammalian Gateway Destination Vector pENTR4-HaloTag (w876-1) - Gateway Entry Vector pCS2+/C-Halo...- Mammalian Expression pENTR4-SNAPf (w878-1) - Gateway Entry Vector pCS2+/C-SNAPf , pCS2+/N-SNAPf - Xenopus...- Mammalian Expression pENTR4-CLIPf (w877-2) - Gateway Entry Vector pET51b-His-TEV-CLIP-tag - Bacterial... -
CRISPR References and Information
TypeCollection...; dCas9 activator gateway donors: pAC84 , pAC1 , pAC147 , pAC148 , pAC149 ; Gateway destination: pAC90... -
Synthetic Biology - Overview
TypeCollection...Recombinant Phosphoprotein Kit S. cerevisiae Advanced Gateway Destination Vectors TAL Effectors Zinc Finger Consortium... -
Adenovirus Plasmids
TypeCollection...pEZYshuttle Shuttle Modified pShuttle-CMV plasmid with Gateway cassette; See article for additional plasmids Zhang... -
RNA Interference in Plant Biology: New Tools for an Old Favorite
TypeBlog Post... which allows easy creation of long hpRNA with Gateway-based cloning and straightforward positive selection... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...assembly. Gersbach MuLE System Mammalian MultiSite Gateway recombination-based cloning of complex polycistronic...plasmids available for use in this Golden Gate and Gateway based assembly method: plasmids for assembly of...a single T-DNA binary vector of choice through Gateway recombination. Qi Multiplex Conditional Mutagenesis... -
Tetracycline Inducible Expression
TypeCollection...Tet-On vector for inducible expression; insert with Gateway cloning and puromycin selection rtTA-Advanced Tight...promoter rtTA3 Wei Xu 26803 pEnt L1L3 EF1a-tTA-2 Gateway entry vector to express tTA from EF1α promoter,... -
Special Delivery: Fluorophore Targeting for FRET Studies
TypeBlog Post...in intact cells. The Gradia Lab has deposited a gateway vector with Addgene, where you can insert your ... -
How to Deposit Your Plasmids with Addgene
TypeBlog Post...For plasmids containing the ccdB gene, such as Gateway vectors, we recommend the ccdB Survival strain.... -
Antibody Validation for Flow Cytometry
TypeBlog Post...page. The data produced is available on the F1000 gateway and Zenodo community. Knockdown approach For... -
Ras Pathway
TypeCollection...vectors from the Esposito Lab for use with the Gateway® Cloning Platform (Life Technologies™) to permit... -
Molecular Cloning Techniques
TypeGuide...completed via Gateway cloning. Addgene's collection contains thousands of Gateway donor , Gateway entry , and...backbone. Created with BioRender.com. Gateway Recombination Cloning Gateway cloning is a recombination-based...experimental goal. Although Gateway cloning is a simple and efficient cloning method, Gateway vectors and recombination...conditions. Read more in our Gateway Cloning blog post . Figure 2: Summary of Gateway cloning. Created with ...Molecular Cloning Techniques Restriction Enzyme Gateway TOPO Gibson Golden Gate & MoClo Ligation Independent...recombination-based cloning method. During Gateway, moving a piece of DNA from one plasmid into another is done via a single...fragment must first be amplified with specific Gateway attB1 and attB2 sites attached to the 5’ and 3’... -
Gamma-Retroviral Vector Guide
TypeGuide...including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction...compatible with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your...yield of DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant... -
Sequencing Primers
TypeGuide...GCATGATGACCACCGATATG 3' end of Gateway cassette Forward GW-5' AATCTCGCCGGATCCTAACT 5' end of Gateway cassette Reverse... -
Adenovirus Guide
TypeGuide...including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction...compatible with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your...yield of DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant... -
Lentiviral Vector Guide
TypeGuide...including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction...compatible with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your...yield of DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant... -
Modular Cloning Guide
TypeGuide...inserts in one cloning step rather than two. Golden GATEway Cloning Kit Other, Zebrafish Expression Joachim...toolkit that combines Golden Gate and Multisite Gateway cloning. This system was specifically designed ... -
Adeno-associated virus (AAV) Guide
TypeGuide...including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction...compatible with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your...yield of DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant...