We narrowed to 63 results for: gateway

...used with Clover pGWF1 Cyan & Yellow Bacterial Gateway-compatible vector to express a gene of interest...

...pMH-Halo tag - Mammalian Gateway Destination Vector pENTR4-HaloTag (w876-1) - Gateway Entry Vector pCS2+/C-Halo...- Mammalian Expression pENTR4-SNAPf (w878-1) - Gateway Entry Vector pCS2+/C-SNAPf , pCS2+/N-SNAPf - Xenopus...- Mammalian Expression pENTR4-CLIPf (w877-2) - Gateway Entry Vector pET51b-His-TEV-CLIP-tag - Bacterial...Neveu Lab MXS Chaining Kit Lindquist Lab Yeast Gateway Kit Reading and Resources Addgene Blog: Which Fluorescent...

...vectors from the Esposito Lab for use with the Gateway® Cloning Platform (Life Technologies™) to permit...

...Additional Resources Addgene Kits MoClo-YTK Yeast Gateway Kit Multiplex Yeast Toolkit (MYT) Markerless Yeast...

...Recombinant Phosphoprotein Kit S. cerevisiae Advanced Gateway Destination Vectors TAL Effectors Zinc Finger Consortium...

...Modified pShuttle-CMV (Addgene #16403) plasmid with Gateway cassette Zhang 50958 ShuttleNSE For production ...

...; dCas9 activator gateway donors: pAC84 , pAC1 , pAC147 , pAC148 , pAC149 ; Gateway destination: pAC90...

... which allows easy creation of long hpRNA with Gateway-based cloning and straightforward positive selection...

...in intact cells. The Gradia Lab has deposited a gateway vector with Addgene, where you can insert your ...

...Tet-On vector for inducible expression; insert with Gateway cloning and puromycin selection rtTA-Advanced Tight...promoter rtTA3 Wei Xu 26803 pEnt L1L3 EF1a-tTA-2 Gateway entry vector to express tTA from EF1α promoter,...

...For plasmids containing the ccdB gene, such as Gateway vectors, we recommend the ccdB Survival strain....

...page. The data produced is available on the F1000 gateway and Zenodo community.  Knockdown approach For...

...vectors from the Esposito Lab for use with the Gateway® Cloning Platform (Life Technologies™) to permit...

...completed via Gateway cloning. Addgene's collection contains thousands of Gateway donor , Gateway entry , and...backbone. Created with BioRender.com. Gateway Recombination Cloning Gateway cloning is a recombination-based...experimental goal. Although Gateway cloning is a simple and efficient cloning method, Gateway vectors and recombination...conditions. Read more in our Gateway Cloning blog post . Figure 2: Summary of Gateway cloning. Created with ...Molecular Cloning Techniques Restriction Enzyme Gateway TOPO Gibson Golden Gate & MoClo Ligation Independent...recombination-based cloning method. During Gateway, moving a piece of DNA from one plasmid into another is done via a single...fragment must first be amplified with specific Gateway attB1 and attB2 sites attached to the 5’ and 3’...

...including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction...compatible with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your...yield of DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant...

...GCATGATGACCACCGATATG 3' end of Gateway cassette Forward GW-5' AATCTCGCCGGATCCTAACT 5' end of Gateway cassette Reverse...

...including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction...compatible with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your...yield of DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant...

...including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction...compatible with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your...yield of DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant...

...inserts in one cloning step rather than two. Golden GATEway Cloning Kit Other, Zebrafish Expression Joachim...toolkit that combines Golden Gate and Multisite Gateway cloning. This system was specifically designed ...

...including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction...compatible with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your...yield of DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant...