We narrowed to 57 results for: luciferase
-
TypeBlog Post...binding sites increased activation of HIV promoter-luciferase constructs. In multiple HIV-1 latent T cell lines...
-
Bacterial Expression Systems
TypeCollection...transcription factors. Addgene Blog Luciferase Technologies Enabled by NanoLuc® Luciferase Fluorescent Biosensors ...easily measurable reporter genes (e.g., LacZ, luciferase, or fluorescent proteins) under the control of...FFluc Promoter activity Luminescence (firefly luciferase) Mycobacterium sp. Brian Robertson , Siouxsie... -
Chemogenetics Guide
TypeGuide...light-emitting luciferase and a light-sensing optogenetic element. When the luciferase substrate (luciferin...luciferin) is added, the luciferase enzyme generates light that activates the opsin. The opsin may excite...Coupling brighter bioluminescent modules, such as luciferase-fluorescent protein fusions, to more-sensitive...increased efficiencies. Depending on the type of luciferase used, the luciferin substrate may be the native...Descriptions of LMOs and their activity in neurons LMO Luciferase Opsin Ligand Effect Outcome (in neurons) Reference... -
Sequencing Primers
TypeGuide...AGTCAAGTAACAACCGCGA 3' end of luciferase, forward primer LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase, reverse primer... primer LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase, reverse primer M13 Reverse CAGGAAACAGCTATGAC...Rluc-F CCAGGATTCTTTTCCAATGC 3' end of Renilla luciferase, forward primer RVprimer3 CTAGCAAAATAGGCTGTCCC... -
Fluorescent Protein Guide
TypeCollection...at Addgene Addgene Blog: Fluorescent Proteins Luciferase Plasmid Collection Fluorescent Protein Kits Allen... -
Fluorescent Proteins: FRET
TypeCollection...Read more about self-labeling tags on our blog . Luciferase can be paired with a fluorescent protein acceptor...Resonance Energy Transfer (BRET) . Browse Addgene's Luciferase Plasmid Collection or the Promega Plasmid Collection... -
Plasmid Collections
TypeCollection...Zinc Fingers Luminescence Fluorescent Proteins Luciferase Optogenetics Chemogenetics Viral Plasmids Lentivirus... -
Molecular Biology Reference
TypeGuide...plasmids contain a reporter gene (for example, luciferase or GFP) that offers a read-out of the activity...of interest could be inserted upstream of the luciferase gene to determine the level of transcription ... -
Cre-Lox and Other Site-Specific Recombinases
TypeCollection...Use this AAV CRISPR knockout library expressing luciferase and Cre to interrogate tumorigenesis in vivo ... -
COVID-19 Resources
TypeCollection... pseudotyped virus. It also lists several luciferase and fluorescent reporter plasmids that have been... -
Tetracycline Inducible Expression
TypeCollection...pSBtet-GP Sleeping Beauty transposon system with luciferase in cloning site. See article ( Kowarz et al.,... -
Validated gRNA Sequences
TypeCollection...AGACGACCCTGTCATCCGCA 74188 cut S. pyogenes 26627737 Moffat Luciferase ACAACTTTACCGACCGCGCC 74190 cut S. pyogenes 26627737... -
Fluorescent Protein Guide: Empty Backbones
TypeCollection...Fusion Construct Kit Neveu Lab MXS Chaining Kit Luciferase Plasmid Collection Promega Plasmid Collection... -
Fluorescent Protein Guide: Biosensors
TypeCollection...You may also like... Addgene Blog: Biosensors Luciferase Plasmids Optogenetics Plasmids Viral Service:... -
Penn Vector Core Partnership with Addgene
TypeCollection...James M. Wilson AV-1-PV0105 105532-AAV1 pAAV.CMV.ffLuciferase.SV40 Control James M. Wilson AV-1-PV1917 105541...James M. Wilson AV-8-PV0105 105532-AAV8 pAAV.CMV.ffLuciferase.SV40 Control James M. Wilson AV-8-PV0146 105535...Karl Deisseroth AV-5-PV0105 105532-AAV5 pAAV.CMV.ffLuciferase.SV40 James M. Wilson AV-5-PV1090 105537-AAV5... M. Wilson AV-8-PV1302 105538-AAV8 pENN.AAV.TBG.PI.ffLuciferase.RBG James M. Wilson AV-8-PV3637 65015-...Karl Deisseroth AV-9-PV0105 105532-AAV9 pAAV.CMV.ffLuciferase.SV40 James M. Wilson AV-9-PV0109 105533-AAV9...Karl Deisseroth AV-2-PV0105 105532-AAV2 pAAV.CMV.ffLuciferase.SV40 James M. Wilson AV-1-PV3365 105554-AAV1... -
Neurodegeneration Plasmid Collection
TypeCollection... MAPT T5, luciferase CMV Parkinson's, FTD Eugene Yeo 214673 lucMAPT-30U MAPT T5, luciferase CMV Parkinson's...FTD Eugene Yeo 214674 lucMAPT-GenRep MAPT T5, luciferase CMV Parkinson's, FTD Eugene Yeo 214814 U6_ ATM_G101... -
Control AAV Preps
TypeCollection... 5, 8 James M. Wilson 105532 pAAV.CMV.ffLuciferase.SV40 CMV ffLuciferase Constitutive 8 James M. Wilson...