We narrowed to 58 results for: luciferase

...to LacZ, plus luciferase-2A-Cre recombinase 60226 : sgRNA cloning backbone with luciferase-2A-Cre recombinase...sgRNAs targeting KRAS , p53 , and LKB1 , plus luciferase-2A-Cre recombinase, and Kras G12D HDR template...plasmid contains two expression cassettes, Renilla luciferase-2A-Cre recombinase and sgRNAs targeting the mouse...plasmid contains two expression cassettes, Renilla luciferase-2A-Cre recombinase and an sgRNA targeted to LacZ...plasmid contains two expression cassettes, Renilla luciferase-2A-Cre recombinase and an sgRNA backbone for ...

...luminescent opsins: fusion proteins of a light-emitting luciferase and a light-sensing optogenetic element such ...such as channelrhodopsin. When the luciferase enzyme oxidizes its substrate (luciferin), it generates light...

...transcription factors. Addgene Blog Luciferase Technologies Enabled by NanoLuc® Luciferase Fluorescent Biosensors ...easily measurable reporter genes (e.g., LacZ, luciferase, or fluorescent proteins) under the control of...FFluc Promoter activity Luminescence (firefly luciferase) Mycobacterium sp. Brian Robertson , Siouxsie...

...receptors that affect cell signalling pathways. Luciferase Plasmids Use bioluminescent reporters for studying...

...Read more about self-labeling tags on our blog . Luciferase can be paired with a fluorescent protein acceptor...Resonance Energy Transfer (BRET) . Browse Addgene's Luciferase Plasmid Collection or the Promega Plasmid Collection...

...pLentipuro3/TO/V5-GW/EGFP-Firefly Luciferase 3rd Expression of EGFP-Firefly luciferase fusion protein. Ethan Abel...

...Zinc Fingers Luminescence Fluorescent Proteins Luciferase Optogenetics Chemogenetics Viral Plasmids Lentivirus...

...Fluorescent Proteins: Subcellular Localization Luciferase Plasmid Collection Viral Vector Packaging Service...

...Use this AAV CRISPR knockout library expressing luciferase and Cre to interrogate tumorigenesis in vivo ...

... pseudotyped virus. It also lists several luciferase and fluorescent reporter plasmids that have been...

...light-emitting luciferase and a light-sensing optogenetic element. When the luciferase substrate (luciferin...luciferin) is added, the luciferase enzyme generates light that activates the opsin. The opsin may excite...Coupling brighter bioluminescent modules, such as luciferase-fluorescent protein fusions, to more-sensitive...increased efficiencies. Depending on the type of luciferase used, the luciferin substrate may be the native...Descriptions of LMOs and their activity in neurons LMO Luciferase Opsin Ligand Effect Outcome Reference LMO3 sbGLuc...

...AGTCAAGTAACAACCGCGA 3' end of luciferase Forward LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase Reverse M13 Forward...Rluc-F CCAGGATTCTTTTCCAATGC 3' end of Renilla luciferase Forward RVprimer3 CTAGCAAAATAGGCTGTCCC 5' of ...

...These plasmids contain a reporter gene (e.g., luciferase or GFP) that offers a readout of the activity...of interest could be inserted upstream of the luciferase gene to determine the level of transcription ...that promoter. Fluorescent Protein Plasmids , Luciferase Plasmids Viral Plasmids These plasmids are modified...

...-emitting luciferase fused to a light-sensing element such as an opsin. When the luciferase substrate ...substrate is added, the luciferase enzyme generates light that activates the opsin. While LMOs can also be activated...

...pSBtet-GP Sleeping Beauty transposon system with luciferase in cloning site. See article ( Kowarz et al.,...

...Michael Davidson Fluorescent Protein Collection Luciferase Plasmid Collection Promega Plasmid Collection...

... MAPT T5, luciferase CMV Parkinson's, FTD Eugene Yeo 214673 lucMAPT-30U MAPT T5, luciferase CMV Parkinson's...237836 OPTN-P1 OPTN Luciferase PGK ALS Angela Ting 237837 OPTN-P2 OPTN Luciferase PGK ALS Angela Ting ...FTD Eugene Yeo 214674 lucMAPT-GenRep MAPT T5, luciferase CMV Parkinson's, FTD Eugene Yeo 214814 U6_ ATM_G101...

...Optogenetics Plasmids Viral Service: AAV Biosensors Luciferase Plasmids Promega Plasmid Collection Explore the...