We narrowed to 481 results for: vent
-
TypeCollection...Eml M. musculus 64071 cut S. pyogenes 25337876 Ventura Amplicon, JAK2 H. sapiens GAGGCATATTCTTCTCCTGG ...
-
Antibody Guide
TypeCollection...block the membrane to remove excess antibody and prevent unwanted binding. Incubate the membrane with a ... -
The Importance of a Fun Workplace: Company Culture at Addgene
TypeBlog Post...Laura’s Top 10 Event Planning Tips! 1. Take suggestions Some of Addgene’s best events have been at the...way Fun events don't have to cost a lot, or anything at all really! We've had plenty of events that included...doing an event that requires people to be in groups, organize your troops prior to the event, and let ...feast and play lawn games. In previous years, this event was held at Executive Director Joanne Kamen’s home...the work vicinity over the weekend, even for an event where there is food and beer. Ha! We had over 60...rain towards the end, it was another successful event! Addgene company culture At Addgene we organically...effort to continue the tradition and plan enjoyable events for employees. We now have a team of three (myself... -
How-to: 5 Steps to a Great Panel Discussion
TypeBlog Post... approach to making the event interesting and engaging. Long before the event... Choose a moderator with...discussions are becoming a ubiquitous format for events and sessions in scientific conferences. They can... a different role so her ability to control the event is what is important. Choose 4 panelists (maybe ...and organizers should develop a list of 4-6 pre-event interview questions. The moderator (possibly with...and it will be impossible to schedule. In the pre-event interviews, the moderator should be taking good ...develop a final list of questions for the actual event, based on these interviews. The idea is to ask questions...and parking information and remind them about the event as it approaches. Room set-up and logistics To... -
Trimmer Lab NeuroMab Collection
TypeCollection...that they are a distinct IgG subclass from the conventional mAb to facilitate multiplex labeling with subclass-specific... -
CRISPR 101: Off-Target Effects
TypeBlog Post...off-target events There are several strategies to lower the predicted frequency of off-target events, many ... editing events will be on target. Thus, if you isolate/sequence/whatever your editing event outcome is...the way of ‘good enough’. Predicting off-target events As mentioned in the above section, there are gRNA...score candidate gRNAs for on-target and off-target event efficiencies. In addition to these tools generating... but also score their probability of off-target events: CRISPOR, Cas-OFFinder, CCTop, and many more. .... Of note, most of these optimized Cas enzymes prevent cutting at mismatched guide sites, but not necessarily... result in a DNA double strand break (DSB), the event required for frameshift and knock-in mutations. ... -
Deep Dive: Fixing and Permeabilizing for Immunofluorescence
TypeBlog Post... - organic solvents and detergents. Organic Solvents As mentioned above, organic solvents can be used...with this type of fixation*. Organic Solvents Organic solvents, generally acetone, methanol, or ethanol...fixatives - chemical cross-linkers and organic solvents. Chemical Cross-Linkers Chemical cross-linkers...cross-linking can block the epitope of some targets, preventing your primary antibody from binding (Fig.1). The...well as a cross-linker. This is because organic solvents can be quite harsh - lipids and soluble proteins...your target epitope (Fig. 1). So, while organic solvents may improve antibody binding for some targets,... can destroy it for others. That said, organic solvents’ impact on lipids means that they are able to ... -
Plasmids 101: Cre-lox
TypeBlog Post...ligated, resulting in the reciprocal crossover event. This event can have three general outcomes based on the...present; intramolecular events happen with greater frequency than intermolecular events, but any two sites ...can be used to induce site-specific recombination events. The system consists of two components derived ...recombinase catalyzes the site specific recombination event between two loxP sites, which can be located either... are on separate DNA molecules, a translocation event is generated at the loxP sites. How can I use Cre-lox... cassette) upstream of a gene of interest will prevent gene expression in the absence of Cre. In the presence...disrupted or deleted. Selection marker removal – in conventional mouse targeting, targeted clones are selected... -
Antibodies 101: Reading a Flow Plot
TypeBlog Post...output is generated through measurement of events. An event is something that passes through the machine...once you realize events are plotted on an invisible Cartesian plane (right.) Each event is plotted by the...it could be debris or unbound antibodies.) Each event read by the machine is plotted as a dot on an X,...axis to generate a dot plot (Figure 1). Clustered events are called a population. ...populations; this indicates the percentage of total events contained in the gated population. Heat maps are...on elevation maps, are used to show frequency of events, instead of relying on clustered dots. In a contour...contour plot, each line contains the same number of events. Thus, contour lines that are close together show... -
Networking and Inspiring Young Scientists at Freshers Fairs
TypeBlog Post...answer is probably no, but these fun and informative events are one of the main ways budding young scholars...societies. Freshers Fairs tend to be used as welcome events for new students that provide ways for students...opportunity for the societies to promote their upcoming events and intro sessions, and give out useful items and...research. The society also organises PhD information events and summer internship information sessions to help...organizes numerous recreational and educational events throughout the year, including a Christmas Chemistry...scientific disciplines, as well as social and networking events. Imperial Synthetic Biology Society, England The...for both students and the general public, career events, and networking meetups. The society hopes to help... -
Science Communication Snapshot: DayCon 2015
TypeBlog Post...News (SITN), we recently sponsored a first-time event called DayCon. DayCon is a one-day conference aimed...student volunteers worked hard to make this Saturday event a success, a true testament to the commitment of...HILS) made it possible to offer DayCon as a free event! Organizing a science conference for the public...DayCon Executive Board, I was fortunate to see the event planning unfold from the very beginning. The board...biomedical sciences and decided to offer a varied format event to keep the audience engaged. The day kicked off.... The future of DayCon DayCon and other similar events show how meaningful science outreach can be, both...scientific resources. SITN hopes to make DayCon a yearly event and to expand the conference to accommodate a larger... -
A New Optogenetic Tool Based on AraC Controls Gene Expression with Blue Light
TypeBlog Post... for any wash…” 🎶- Barbara Di VenturaIf you follow Barbara Di Ventura on Twitter, you might have seen...graphical abstract, it’s a musical abstract,” says Di Ventura, a professor at the University of Freiburg. This...limit. pic.twitter.com/j6rhCCby2m — Barbara Di Ventura (@barbara_synbio) May 13, 2021 The original AraC...biotechnology, and almost every microbiology lab,” says Di Ventura. It relies on the sugar arabinose to activate transcription...reversibility that you cannot do with AraC,” says Di Ventura. BLADE activates transcription with the flick of... one of the several optogenetic tools that Di Ventura’s lab and Khammash's lab have created and shared...You can find all the plasmids deposited from Di Ventura's lab, including the popular light-inducible nuclear... -
Antibodies 101: Introduction to Gating in Flow Cytometry
TypeBlog Post...cells, the single cell gate to exclude duplicate events, and the Live/Dead gate to focus your analysis ...my lymphocyte population (10.7% of all recorded events) based on their expected size. The strong signals...here. I am not worried about including irrelevant events in my analysis, as these will get excluded through...the next plot! Pro tip! If you only get very few events at the end of your gating pipeline, it might be..., you will likely need to exclude all duplicate events (two cells stuck together) from your single cells...while H and W do not; see Figure 2), single cell events will show up in a straight line one the plot, while...FSC-A we can gate on single cells and exclude any events where multiple cells were clumped together. (B)... -
New and Upcoming Viral Vectors - September 2019
TypeBlog Post...Testing AAV inventory for the entire collection! We are expanding our entire control AAV inventory to give...addition to our inventory of Cre-dependent GABA sensors. See all our GABA sensor AAV inventory here. pAAV.hSynap.iGABASnFR...service in 2016, we’ve added many new tools to our inventory of ready-to-use viral vectors. Here are some of...few months. You can also browse our entire AAV inventory. Our new AAVs include: EGFP-expressing AAV for...Encoded Calcium Sensors). We are expanding the inventory of these vectors to more serotypes. We currently... GCaMP7f and GCaMP7s. See all our biosensors inventory, and check out our latest vectors below: pGP-...growing field that we aim to support by growing our inventory of recombinases and recombinase-dependent vectors... -
New and Upcoming Viral Vectors - June 2019
TypeBlog Post...service in 2016, we’ve added many new tools to our inventory of ready-to-use viral vectors. Here are some of...few months. You can also browse our entire AAV inventory. Our new AAVs include: Control AAVs for serotype...always excited to add new control AAVs to our inventory since we know that scientists need these tools...popular control AAV encoding GFP. Check out our inventory of serotype testing AAV New control AAVs Plasmid...Dana et al., 2018). See our full biosensor AAV inventory New glutamate sensors Plasmid Serotype Name.../ Chemogenetics AAV We have also expanded our inventory of chemogenetic AAV for activating and inhibiting...be activated with FDA-approved drugs. See our inventory of DREADDs / Chemogenetics AAVs New DREADDs ... -
Generating Mouse Models Using CRISPR/Cas9
TypeBlog Post...while with conventional gene targeting, the cost may be $50,000. Finally, compared to conventional methods...easy. In the 1980s, gene targeting technology was invented to introduce specific changes into the mouse genome...CRISPR mouse experiment Everything changed with the advent of CRISPR in 2013 (Cong et al., 2013)! Haoyi got...mouse models using CRISPR is easier than more conventional methods. Time and money savings come from the...reagents directly into fertilized mouse eggs, circumventing the need for enrichment and selection offered...of CRISPR mouse editing when compared to more conventional methods. First, one can work with almost any...any strains of mice, as compared with conventional gene targeting, which is limited to a few strains, including... -
Four Base Editing Reporters to Monitor and Enrich Editing in Real-time
TypeBlog Post...scientists to not only easily identify base editing events in real-time but also enrich for base-edited cells...single base edits (St. Martin et al., 2018). To circumvent sequencing and the need for a DSB in their previous...TLDR: The eGFP reporters from the Harris Lab circumvents the need for DSBs in monitoring on-target DNA...to a ‘TAC’ or ‘TAT’ after a C-to-T base editing event. This edit changes the histidine to a tyrosine generating...emission spectra. Thus a successful base editing event would result in GFP fluorescence that can be visualized...variant that converts to GFP after a base editing event. GFP positive cells can be sorted and have a significantly...reporter that detects and enriches for base editing events in vivo without relying solely on GFP (Katti et... -
Engaging with science and society at pgEd
TypeBlog Post...organize events that bring different voices together to talk about genetics. In addition to events that we...stream of events mean that there is never a dull day in the office. And in the run-up to a major event, such...benefiting from the fruits of scientific research, and prevent technological advances from exacerbating existing...experiences in a variety of other settings, including “conventional” academic venues such as scientific, educational...industry conferences, as well as schools, community events, churches or mosques. On occasion, we also get ...getting experience in either giving or running these events will be important both in preparing you for future... -
Sequencing Options for CRISPR Genotyping
TypeBlog Post... This means they do not reliably detect editing events that occur in less that 5% of the population (Fu...genome predicted to contain off-target cleavage events. Unbiased techniques search the whole genome for...irreproducible data in a research setting, but these events could have disastrous health effects in the clinic...a result, only sequencing sites predicted by conventional algorithms may not provide a full picture of...a more comprehensive list of off-target editing events. Two of the most common cell-based methods are ...should give a broad picture of all possible editing events in the genome; from there, amplicon sequencing ...necessary for every CRISPR experiment. Off-target events due to >3 bp mismatches or that are sequence-independent... -
CRISPR 101: Making a Knock-In Cell Line
TypeBlog Post...mutations and gene editing Targeted genome editing events fall into two general classes: knock-in and knock-out...frameshift mutation. The majority of cellular repair events will generate these types of mutations, making ...considerations for designing donor DNA for successful HDR events. CRISPR cut site location Position your CRISPR...disrupting mutations in donor DNA Promoting HDR events over other edits Like I said earlier, HDR is not...shown to be efficacious for increasing knock-in events (Yang et al., Int J Mol Sci). Adding these inhibitors... to exist as a repair template. To maximize HDR events, ensure cells are actively cycling through the ...Charpentier et al., Nat Com). Fig. 3: HDR events compete with NHEJ-mediated edits of small insertions...