Skip to main content

We narrowed to 635 results for: gats

Showing: 621 - 635 of 635 results
  1. Antibody Guide

    Type
    Guide
    ...components can interfere with the conjugate or conjugation process. Sodium azide, an antimicrobial agent,... back to buffers after the conjugation reaction is complete. HRP-conjugated antibodies should not be stored...done through a conjugation reaction. Many antibodies can be purchased already conjugated, which can save...you want is not available pre-conjugated, or is not available conjugated to your signaling molecule of...indirect detection method uses an unconjugated primary antibody and a conjugated secondary antibody specific...well plate. A conjugated primary antibody is used to bind to the antigen and the conjugate, typically HRP...indirect sandwich method, a conjugated secondary antibody is added. The conjugate is activated and the output...
  2. Sequencing Primers

    Type
    Guide
    ...end of Gateway cassette Forward GW-5' AATCTCGCCGGATCCTAACT 5' end of Gateway cassette Reverse H1 TCGCTATGTGTTCTGGGAAA...GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae GPD promoter Forward GW-3' GCATGATGACCACCGATATG 3' end .../pUC Reverse AGCGGATAACAATTTCACACAGG In lacZ gene Reverse MBP-F GATGAAGCCCTGAAAGACGCGCAG 3' end of maltose...promoter Forward Myc GCATCAATGCAGAAGCTGATCTCA Myc tag Forward Neo-F CGTTGGCTACCCGTGATATT 3' end of neomycin... OpIE2 Forward CGCAACGATCTGGTAAACAC OpIE2 promoter Forward pACYC-F TGAAGTCAGCCCCATACGAT p15A origin Forward...pBluescriptSK TCTAGAACTAGTGGATC For pBluescript vector Reverse pBMN 5' GCTTGGATACACGCCGC MMLV sequence...Forward GCTCGATACAATAAACGCC Rous sarcoma virus (RSV) promoter Forward pRS-marker CGGCATCAGAGCAGATTGTA To sequence...
  3. Molecular Cloning Techniques

    Type
    Guide
    ...Techniques Restriction Enzyme Gateway TOPO Gibson Golden Gate & MoClo Ligation Independent Cloning Yeast-...completed via Gateway cloning. Addgene's collection contains thousands of Gateway donor , Gateway entry , and... of Golden Gate cloning. Created with BioRender.com. Ligation Independent Cloning Ligation Independent...backbone. Created with BioRender.com. Gateway Recombination Cloning Gateway cloning is a recombination-based...experimental goal. Although Gateway cloning is a simple and efficient cloning method, Gateway vectors and recombination...conditions. Read more in our Gateway Cloning blog post . Figure 2: Summary of Gateway cloning. Created with ...degrade over time, further reducing ligation efficiency. TOPO-ready Gateway entry plasmids are also available...
  4. Modular Cloning Guide

    Type
    Guide
    ...plants. GreenGate 2.0 Toolkit Plant Expression Alexis Maizel 68 plasmids to extend the GreenGate Cloning...with the Golden Gate TALEN and TAL Effector Kit (Voytas and Bogdanove). Platinum Gate TALEN Kit Genome...Golden Gate assembly of 15-16 RVD TALEN inserts in one cloning step rather than two. Golden GATEway Cloning...Wittbrodt A toolkit that combines Golden Gate and Multisite Gateway cloning. This system was specifically... Applications and Kits Blog: Plasmids 101 Golden Gate Cloning Synthetic Biology Plasmids Modular Cloning...Weber et al., 2011). This method, based on Golden Gate plasmid assembly, exploits the ability of Type IIS...with complementary overhangs can be digested and ligated in a single step resulting in a 4-bp fusion site...
  5. Guide to Using Pooled Libraries

    Type
    Guide
    ...false positives or false negatives in later experiments, and can also negatively affect data reproducibility...in postivie or negative screens. The use of appropriate controls (positive and negative) is the responsibility...selection mechanism Negative screens are a little trickier than positive screens. In a negative screen, the goal.... To make a cDNA library, cDNA is synthesized, ligated to adapters, and then cloned into a given vector...random chance that could lead to false positive or negative results – for a given plasmid, think of each cell...be divided into two types: positive screens and negative screens. Both types of screen employ a selection... Created with BioRender.com. Both positive and negative screens follow the same basic process. Before ...
  6. Optogenetics Guide

    Type
    Guide
    ... fall into two main types: tools based on light-gated ion channels known as opsins (including chimeric...neuronal activity, but they can be deployed to interrogate and control a wide variety of processes across... activating the neuron. Opsins Opsins are light-gated ion channels or pumps that absorb light at specific...ChRs. These ChR variants still function as light-gated cation channels resulting in excitation (depolarization...identified in other species. By acting as light-gated chloride channels, these variants result in the ...theta ). Halorhodopsins Halorhodopsins are light-gated, inward-directed chloride pumps isolated from halobacteria...Description Peak excitation λ (nm) ChR2 Widely used light-gated cation channel from Chlamydomonas reinhardtii (CrChR2...
  7. Molecular Biology Reference

    Type
    Guide
    ...Common Bacteria Strains for Propagating Plasmids E. coli are gram-negative, rod-shaped bacteria naturally...by a type of horizontal gene transfer called conjugation. Like chromosomal DNA, plasmid DNA is replicated...are now used for a variety of studies used to investigate promoters, small RNAs, and other genetic elements...site (Figure 2). These elements allow for the propagation of the plasmid within bacteria, while allowing...insertion of DNA by restriction enzyme digestion and ligation. As a general rule, the restriction sites in the...lab. Regardless of type, plasmids are generally propagated, selected for, and their integrity verified prior...fragment. Commonly used cloning vectors include Gateway entry vectors and TOPO cloning vectors. Empty Backbones...
  8. Promoters

    Type
    Guide
    ...regulation can be either negative or positive. Repressor proteins bind to negative-repressible operons and...The Lac operon in bacteria is an example of a negatively-controlled operon (Figure 3). A positive-repressible...Constituitve Mammalian Strong promoter from human elongation factor 1 alpha PGK Constitutive Mammalian Promoter...GAPDH TEF1 Constitutive Yeast Yeast transcription elongation factor promoter TRE Inducible Multiple Tetracycline...
  9. Chemogenetics Guide

    Type
    Guide
    ...using Chemogenetics plasmids in your lab for interrogation of neuronal activity....coupled with an ion pore domain (IPD) to form ligand-gated ion channels (LGICs) that can either excite or inhibit...neuronal activity. Figure 3: PSAM4-based ligand-gated ion channels, their effect, and outcome in neurons...S.M., Roth, B.L. (2014). Chemogenetic tools to interrogate brain functions. Annu Rev Neurosci, 37 , 387–...DREADD Facilitates the Multiplexed Chemogenetic Interrogation of Behavior. Neuron, 86 (4), 936–946. https:...
  10. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction...compatible with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your...yield of DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant...Cells AAV Purification by Iodixanol Gradient Ultracentrifugation AAV Titration by ddPCR AAV Titration by qPCR... that enhances DNA replication by stimulating elongation and stabilizing the displaced single-stranded...
  11. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction...compatible with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your...yield of DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant...gamma-retroviral vector purification by high-speed centrifugation for CAR T cell manufacturing. Molecular Therapy...
  12. Lentiviral Vector Guide

    Type
    Guide
    ...including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction...compatible with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your...yield of DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant...unwanted side effects. This concern can be partially mitigated through the use of tissue-specific promoters and...
  13. Plan Your Experiment

    Type
    Guide
    ...bound to the DNA can interfere with transcription elongation. CRISPR Activation : Target the transcription...containing the gRNA scaffold using standard restriction-ligation cloning. However, the exact cloning strategy will...., Sousa-Luís, R., & Proudfoot, N. J. (2023). Elongation roadblocks mediated by dCas9 across human genes...
  14. Adenovirus Guide

    Type
    Guide
    ...including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction...compatible with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your...yield of DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant...
  15. Science Guides

    Type
    Guide
    ...Antibody-based applications, which often use antibodies conjugated to a signaling molecule, can be used to capture...engineered receptors to selectively control and investigate cell signaling pathways. Receptors are remotely...
Showing: 621 - 635 of 635 results