Skip to main content
Addgene
Showing: 91 - 120 of 1024 results

  1. Fluorescent Protein Guide

    Type
    Collection
    ...genetically engineered cellular receptors that affect signalling pathways within cells. Subcellular Localization...measure, and control molecular signals, cells, or groups of cells with either actuators or sensors. Chemogenetics...Monitor small biomolecules or other physiological intracellular processes with genetically encoded fluorescent...where your protein of interest resides by using a well-characterized fluorescent fusion protein. In Vivo...tagged with a variety of fluorescent proteins, as well as over 100 empty backbones. Fluorescent Protein...

  2. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ... Anti-Pan-Neurofascin (extracellular) [A12/18R] Pan-Neurofascin (extracellular) Rat Mouse IgG2a 177439...Anti-Kv1.4 K+ channel (extracellular) [L71/5R] Kv1.4 K+ channel (extracellular) Rat Mouse IgG2a 177489...Mouse IgG2a 177564 Anti-ADAM22 (extracellular) [N57/2R] ADAM22 (extracellular) Mouse Mouse IgG2a 177565 Anti-GluN2B...Anti-Kv1.4 K+ channel (extracellular) [L71/22] Kv1.4 K+ channel (extracellular) Rat Mouse IgG2a 190292...-Neurofascin (extracellular) scFv [A12/18] A12/18 scFv 2t Pan-Neurofascin (extracellular) Rat Mouse 190486...Kv1.4 K+ channel (extracellular) scFv [L71/5] L71/5 scFv Kv1.4 K+ channel (extracellular) Rat Mouse 190518... Mouse 190537 LRP4 (extracellular) scFv [N207/27] N207/27 scFv LRP4 (extracellular) Mouse Mouse 190538...

  3. CRISPR References and Information

    Type
    Collection
    ...and introducing it into cells. Protocol for Genomic Deletions in Mammalian Cell Lines CasPEDIA : An encyclopedia...interest and correspond to edited and non-edited cell populations. For more information, see the bioRxiv...quantification and visualization of CRISPR-Cas9 outcomes, as well as comprehensive evaluation of their effect on the...), clone (primer design), and evaluate gRNAs, as well as predict off-targets, for CRISPR in 180+ genomes...Lab , a sgRNA design tool for genome editing, as well as gene regulation (repression and activation). ...identify novel gRNA target sites in a single gene, as well as a target site common to a set of similar sequences...134.7 KB Musunuru CRISPRs in human pluripotent stem cells pCas9_GFP ; gRNA empty vector Link O'Connor-Giles...

  4. Genetic Code Expansion

    Type
    Collection
    ...expanding the genetic code in bacteria and mammalian cells....codons, and tRNA synthetases are introduced into the cell on plasmids and the new amino acid is introduced...Once these plasmids have been introduced in the cells, the non-canonical amino acid can be incorporated...match the growth medium, ncAA concentration, and the cell lines used previously. Remember that the orthogonal... – GFP for E. coli or mCherry-GFP for mammalian cells. You should also express the protein with and without...tRNA synthetase for use in E.coli and Mammalian Cells. Many of the plasmids also contain one or more copies...coli azi-donorleucine (Anl) Bacterial ATG David Tirrell 62598 pKPY514 phenylalanyl-tRNA synthetase subunit...

  5. AAV Molecular Tools

    Type
    Collection
    ...Scanziani Tools for Cell Ablation These AAV encode tools that can be used for cell ablation. ID Name Expression...toxin receptor fused to GFP for studying cell ablation. 2 Jessell , Azim 45580 pAAV-flex-taCasp3-TEVp EF1a-driven...designer pro-taCasp3 and TEVp for studying cell ablation. 5 Shah , Wells Don’t See What You’re Looking For? Our...Transactivators Affinity Purification Neurophysiology Cell Ablation Tetracycline Transactivators and Inducible...

  6. iPSC Neurodegenerative Disease Initiative Plasmid Collection

    Type
    Collection
    ...nucleotide variant lines in an isogenic cellular background. All cell lines and phenotypic datasets that result...CRISPR Guide CRISPR Protein Tagging Plasmids for Stem Cell Research Neurodegeneration Research Collection The...Plasmids The following plasmids can be used to create cell lines with endogenously-tagged gene variants or ...or to differentiate human iPSCs into other cell types, as noted in the purpose field: ID Plasmid Description...neurodegenerative diseases with genomic engineering: A new stem cell initiative from the NIH. Neuron . 2021 Apr 7;109...

  7. CRISPR Plasmids for Genomic Visualization

    Type
    Collection
    ...-repetitive genomic loci, as well as chromosome painting in living cells. Visualizing a specific genomic...compatible with fluorescence microscopy in living cells. Alternatively, gRNAs can be fused to protein-interacting... multiple genomic loci, and compatible with live cell imaging. Compared to techniques like fluorescence... for detecting the chromatin dynamics in living cells. The fluorescent CRISPR system has been used for...repetitive loci can be efficiently visualized in living cells using a single gRNA that has multiple targeted sequences...

  8. Institute for Protein Innovation

    Type
    Collection
    ... of cell surface and secreted proteins (glypicans and integrins) and common epitope tags, as well as antibody...unique recombinant antibodies targeting families of cell surface and secreted proteins from a collaboration...mission, IPI is providing access to high-quality, well-characterized antibodies in an open science model...highly conserved proteoglycans crucial for regulating cell signaling during development. The IPI collection...antibodies that target epitope tags and other common cellular proteins. ID Recombinant Antibody Description ...

  9. Optogenetics Plasmid Collection

    Type
    Collection
    ...kinetic properties as well as improve the expression and membrane targeting in host cells. Other microbial ... optical switch tools to measure and manipulate cells and their biomolecular processes. Plasmid...to blue light and allows cations to flow into the cell. Variants of channelrhodopsin have been engineered...actively move cations or anions into or out of the cell. When using these opsins as a tool to control neuronal...plasmids that use light to control a protein or cellular activity. For example, search "Cdc42", "transcription...

  10. Retrovirus Plasmids

    Type
    Collection
    ...reverse transcriptase and integrase. Once in a target cell, the virus uses the reverse transcriptase in tow...γ-retroviruses are that they can only transduce dividing cells (this is because they are only able to enter the...of Large T antigen for creation of immortalized cells (see Weinberg Lab page for resistance variants) ...Expression of hTERT for creation of immortalized cells; additional plasmids include Puro resistance and...inducible expression of GFP T2A Cre fusion in mammalian cells Foijer 47916 pRXTN CMV/MSV pRXTN is a modified version...MoMSV Stable expression of luciferase in mammalian cells Wong Return to Top Do you have suggestions for other...

  11. Antibody Plasmid Collection

    Type
    Collection
    ...expressing these in bacteria, mammalian cells, yeast, plants, or insect cells. Benefits include consistency between...application-specific validation and quality control by Addgene as well as by our trusted partner labs. Learn More Cloning... research purposes include animals or hybridoma cells, but are difficult to generate due to expense and...monoclonal antibodies (R-mAbs) expressed in mammalian cells. Monoclonal antibodies are derived from an individual...transiently transfected into mammalian tissue culture cells, the R-mAbs are secreted into the culture media ...

  12. Worm Expression Resources

    Type
    Collection
    ...maintenance. Worms are particularly well suited for studies in cell biology, development, and aging. Scientists.... elegans hermaphrodite consists of 959 somatic cells, which makes them attractive for imaging and fluorescence...microscopy experiments. The C. elegans genome is well studied and hundreds of reporters have been developed...researchers to express desired constructs in precise cell types and/or developmental timeframes. Here we highlight...detection of genome-editing events. Developed in Craig Mello's lab and described in A Co-CRISPR Strategy for Efficient...

  13. CRISPR Plasmids - Mammalian Expression

    Type
    Collection
    ...sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ), a mechanism...PAM site. When a repair template is present, the cell may repair a DSB using homology-directed repair ... time and are potentially heritable in dividing cells. ID Plasmid Gene/Insert Selectable Marker PI Publication...DNA. Type VI enzymes that function in mammalian cells can be used to attentuate RNA levels. In mammalian...genomic loci using fluorescent microscopy in living cells. Design your gRNA sequence to direct the dCas9-FP...Cas protein and a target-specific gRNA in the same cell at the same time. Single plasmids containing both...

  14. Control AAV Preps

    Type
    Collection
    ...pAAV-hDlx-Flex-GFP-Fishell_6 Dlx GFP Cre dependent 1, 2, 8, 9, rg* Fishell 83894 pAAV-hDlx-Flex-dTomato-Fishell_7 Dlx...83900 pAAV-mDlx-GFP-Fishell-1 Dlx GFP Constitutive 1, 2, 5, 8, 9, rg*, PHP.eB Fishell 99130 pAAV-mDlx-NLS-mRuby2...Dlx dTomato Cre dependent 1, 2, 5, 9, rg* Fishell 100043 pAAV.synP.DIO.EGFP.WPRE.hGH Syn EGFP Cre dependent...

  15. Lentivirus Plasmids

    Type
    Collection
    ...Lentivirus can transduce both dividing and non-dividing cells without a significant immune response. These viruses... in the viral particle) is delivered to a target cell upon infection. When lentivirus is used for research...the researcher wants delivered to specific target cells. This genome is encoded by plasmids called "transfer...encoded by the transfer plasmid is toxic to mammalian cells, it can be difficult to efficiently produce viral...of viral transduction. Also see plasmid 46948 . Elledge 44011 pInducer10-mir-RUP-PheS 3rd Lentiviral shRNA...transduction. See article for more similar plasmids. Elledge 21373 pHIV-EGFP 3rd EF-1alpha driven expression...

  16. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...YPet-pBAD - Bacterial Expression ZsYellow1 529 539 8 Tetramer ZsYellow1-N1 - Mammalian Expression mPapaya1...Fluorescent Protein Resources: FRET Biosensors Subcellular localization Michael Davidson Collection Blog...More References below Jump to: Blue/UV Cyan Green Yellow Orange Red Far-Red Near-Infrared Long Stokes Shift...Cloning Vector - Mammalian Expression Jump to Top Yellow Protein Excitation (nm) Emission (nm) Brightness...2011, pp. 313–327 Scholarpedia : Entry by Robert Campbell Spectra Database : Graphing site hosted at the...University of Arizona Shaner et al. : Journal of Cell Science, Vol. 120, December 2007, pp. 4247-4260 ...

  17. Zinc Finger Consortium: OPEN Reagents

    Type
    Collection
    ...function in zebrafish, plants, and human cells ( Maeder et al., Mol Cell 2008 , Foley & Yeh et al., PLoS ONE... Townsend et al., Nature 2009 , Zou et al., Cell Stem Cell 2009 ). Resources A detailed protocol for practicing...ZFNs that function in zebrafish, plants, and human cells Kits...

  18. Antibody Production

    Type
    Collection
    ...mammalian expression vectors, human embryonic kidney cells are transfected with the plasmid(s) encoding the.... This buffer is not compatible for use in live cells and will interfere with conjugation. For applications...antigen is first transiently expressed in mammalian cells. To learn which specific QC experiments were performed...email [email protected] . Immunocytochemistry (ICC) Cells are fixed and labeled with the antibody and a species-specific...Western Blotting (WB) Proteins are extracted from cells, separated by SDS-PAGE, transferred to a membrane...

  19. Chemogenetics AAV Preps

    Type
    Collection
    ...-GiDREADD-dTomato-Fishell-5 hM4D(Gi) - Inhibition NLS-dTomato none 1, 9, rg* Fishell 83897 pAAV-hDlx-GqDREADD-dTomato-Fishell...-GqDREADD-dTomato-Fishell-4 hM3D(Gq) - Activation NLS-dTomato none 1, 9, rg* Fishell 50472 pAAV-GFAP-HA-rM3D... chemically induce neuronal activity in specific cell types. See our Chemogenetics Plasmids and Chemogenetics...

  20. Microbiology Resources

    Type
    Collection
    ... Ralstonia solanacearum Rickettsia sp. Salmonella sp. Shigella sp. Staphylococcus sp. Streptococcus sp...Species Anabaena sp. Bacillus sp. Burkholderia sp. Bordetella pertussis Campylobacter sp. Chlamydia sp. Clostridium...reading frames for vaccinia virus - Bennink and Yewdell Labs Yarrowia lipolytica Golden Gate tool kit :...applications like recombinant protein purification and cell-free circuit design in E. coli - Freemont Lab MoClo-YTK...

  21. CRISPR Plasmids - Bacteria

    Type
    Collection
    ...to activate programmed cell death or dormancy for phage-infected bacterial cells so as to limit the spread...sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ), a mechanism...PAM site. When a repair template is present, the cell may repair a DSB using homology-directed repair ...Cas protein and a target-specific gRNA in the same cell at the same time. Single plasmids containing both...

  22. Feng Zhang Multiplexed Overexpression of Regulatory Factors (MORF) Collection

    Type
    Collection
    ...be used for screening transcription factors for cellular programming or cancer drug resistance....Zhang Lab Plasmids The Human TFome Library Stem Cells Protocols & References MORF Plasmids MORF Pooled...transcription factors for applications such as cellular programming or cancer drug resistance. Protocols...Fu Z, Macrae RK, Buenrostro JD, Regev A, Zhang F. Cell 2023 Jan 5; 186(1):209-229. PubMed (Link opens in...

  23. Cancer Research Plasmids and Resources

    Type
    Collection
    ...important to normal cell signaling and physiology, and, when dysregulated, can enable cancer cell survival. Although...that is essential for regulating the growth of the cell. p53 p53, the most frequently mutated gene in human...somatic variants found in lung adenocarcinoma as well as variants found across cancer types as part of...

  24. Synthetic Biology - Overview

    Type
    Collection
    ...George Church Cynthia Collins James Collins Tom Ellis Drew Endy Tobias Erb Susan Golden John Gray Jeff... Keasling Taek Soon Lee Joshua Leonard Han Lim Wendell Lim Timothy Lu Michel Maharbiz Thorsten Mascher...Sensing and Signaling Browse plasmids related to intercellular signaling and environmental sensing. Strains... Circuit Transfer C. Collins Lab Quorum Sensing Ellis Lab GeneGuard Endy Lab Logic Gates , BIOFAB Promoter...

  25. Adenovirus Plasmids

    Type
    Collection
    ...target a broad range of dividing and non-dividing cell types with almost 100% efficiency. Unlike lentiviruses...adenoviruses include transient transgene expression, as well as the substantial immune response induced by the...recombination of adenovirus plasmids in either mammalian cells or microorganisms, including bacteria and yeast....can then be transfected into mammalian packaging cell lines to generate adenovirus particles. Read our...

  26. Adeno-associated virus (AAV) Plasmids

    Type
    Collection
    ...e.g., pHelper) and specific packaging cell lines (e.g., HEK293 cells) during AAV production. Read our AAV...AAV can transduce both dividing and non-dividing cells with a low immune response and low toxicity. Although...in-stock preps that are ready to ship right away, as well as our Packaged on Request service to give you more...

  27. Rinehart Lab Phosphoprotein Reagents

    Type
    Collection
    ...abundant forms of posttranslational modifications in cells and research into its many roles in protein function...interactions can be discovered by fluorescence-activated cell sorting (FACS). The mode #2 phosphosite library ... Production of Recombinant Phosphoproteins Using Cell-Free Protein Synthesis. Oza JP, Aerni HR, Pirman...Ordureau A, Paulo JA, Rinehart J, Harper JW. Molecular Cell . 2015. Sep 9. pii: S1097-2765(15)00662-0. doi: ...

  28. Validated gRNA Sequences

    Type
    Collection
    ... 24879462 Mello avr-15 C. elegans GTTTGCAATATAAGTCACCC 58982 cut S. pyogenes 24879462 Mello AXIN2 H. sapiens... compiled from plasmids in Addgene's database as well as from sequences provided to us by users (see below...GAACCCGTTGCCGAATACAC 58202 cut S. pyogenes 24879462 Mello unc-58(e665) C. elegans TCCACGCACATGGTCACTA 59931...GGATGGATGTGTAGTCAATT 61250 cut S. pyogenes 25491644 Ward yellow D. melanogaster GGTTTTGGACACTGGAACCG 49331 cut ...

  29. Optogenetics AAV Preps

    Type
    Collection
    ...pAAV-mDlx-ChR2-mCherry-Fishell-3 Dlx ChR2 mCherry Constitutive 1, 9, rg* Fishell 135634 pAAV-S5E2-ChR2-...Optogenetics AAV Optogenetic tools can be used to control cell activity in living tissue with light. Optogenetics...Fluorophore GFP Red-wavelength fluorescent protein Yellow-wavelength fluorescent protein Blue-wavelength ...

  30. Michael Davidson Fluorescent Protein Collection

    Type
    Collection
    ...Fluorescent Protein Resources: Empty Backbones FRET Subcellular localization Optogenetics The lab of Michael ...Backbones mEmeralds Reds Blues Cyans Oranges Greens Yellows Photoactivatables Empty Backbones Plasmid Description...Description Industry Greens Plasmid Description Industry Yellows Plasmid Description Industry Photoactivatables ...
Showing: 91 - 120 of 1024 results